

Gene Therapy Shows Promise in Treating Fanconi Anemia
A Spanish-led team successfully used gene therapy to treat Fanconi anemia in nine children, achieving significant improvements and offering a safer alternative to bone marrow transplants.
Gene Therapy Shows Promise in Treating Fanconi Anemia
A Spanish-led team successfully used gene therapy to treat Fanconi anemia in nine children, achieving significant improvements and offering a safer alternative to bone marrow transplants.
Progress
16% Bias Score


Antibiotic Resistance: Latin American Scientists Offer Hope Amidst Global Crisis
Antibiotic resistance caused 1.27 million deaths in 2019, prompting research into new treatments like novel synthetic antibiotics in Chile and bacteriophage therapies in Uruguay and Colombia, facing challenges in funding and regulation.
Antibiotic Resistance: Latin American Scientists Offer Hope Amidst Global Crisis
Antibiotic resistance caused 1.27 million deaths in 2019, prompting research into new treatments like novel synthetic antibiotics in Chile and bacteriophage therapies in Uruguay and Colombia, facing challenges in funding and regulation.
Progress
24% Bias Score


Milei rallies global ultra-right at CPAC Buenos Aires
The Conservative Political Action Conference (CPAC) held its first meeting in Buenos Aires, Argentina, on Wednesday, concluding with a speech by President Javier Milei, who, alongside other prominent right-wing figures, criticized leftist leaders and promoted a global ultra-right movement. Hundreds ...
Milei rallies global ultra-right at CPAC Buenos Aires
The Conservative Political Action Conference (CPAC) held its first meeting in Buenos Aires, Argentina, on Wednesday, concluding with a speech by President Javier Milei, who, alongside other prominent right-wing figures, criticized leftist leaders and promoted a global ultra-right movement. Hundreds ...
Progress
68% Bias Score


Captain Arrested for Rape, 15 Others Charged with Failing to Intervene
The captain of a migrant boat that arrived in Formentera on Saturday is accused of raping a 17-year-old female passenger; 15 other male passengers face charges for failing to help her.
Captain Arrested for Rape, 15 Others Charged with Failing to Intervene
The captain of a migrant boat that arrived in Formentera on Saturday is accused of raping a 17-year-old female passenger; 15 other male passengers face charges for failing to help her.
Progress
60% Bias Score


Spain Unveils 100-Point Africa Strategy
Spain launched a new foreign policy strategy for Africa, outlining 100 measures for youth development, sustainable growth, and green energy, aiming for an equal partnership and addressing security and investment opportunities, while facing competition from other global powers.
Spain Unveils 100-Point Africa Strategy
Spain launched a new foreign policy strategy for Africa, outlining 100 measures for youth development, sustainable growth, and green energy, aiming for an equal partnership and addressing security and investment opportunities, while facing competition from other global powers.
Progress
48% Bias Score


Georgia: Violent Crackdown on Anti-EU Protests Sparks International Condemnation
The Georgian government violently suppressed protests against its decision to halt EU accession talks, leading to hundreds of arrests, dozens of injuries, and international condemnation, raising concerns about democratic backsliding and prompting threats of sanctions from the US and EU.
Georgia: Violent Crackdown on Anti-EU Protests Sparks International Condemnation
The Georgian government violently suppressed protests against its decision to halt EU accession talks, leading to hundreds of arrests, dozens of injuries, and international condemnation, raising concerns about democratic backsliding and prompting threats of sanctions from the US and EU.
Progress
44% Bias Score

Yamal Orchestrates Barcelona's 5-1 Victory Over Mallorca
Lamine Yamal, a 17-year-old FC Barcelona winger, orchestrated their 5-1 victory over Mallorca on Tuesday, creating three goals and initiating another, despite not scoring himself; Barcelona has won all 16 matches where he started.

Yamal Orchestrates Barcelona's 5-1 Victory Over Mallorca
Lamine Yamal, a 17-year-old FC Barcelona winger, orchestrated their 5-1 victory over Mallorca on Tuesday, creating three goals and initiating another, despite not scoring himself; Barcelona has won all 16 matches where he started.
Progress
48% Bias Score

Colombian Finance Minister Resigns Amid Corruption Scandal
Ricardo Bonilla resigned as Colombia's Minister of Finance following accusations of contract redirection for political gain, leaving the government facing budgetary challenges and raising questions about President Petro's approach to corruption within his administration.

Colombian Finance Minister Resigns Amid Corruption Scandal
Ricardo Bonilla resigned as Colombia's Minister of Finance following accusations of contract redirection for political gain, leaving the government facing budgetary challenges and raising questions about President Petro's approach to corruption within his administration.
Progress
52% Bias Score

French Government Collapses After No-Confidence Vote
Michel Barnier's government, appointed by Emmanuel Macron after legislative election losses, collapsed on Wednesday following a no-confidence vote in the French National Assembly, becoming the shortest-lived government in the Fifth Republic and leaving France without a budget at the end of the year.

French Government Collapses After No-Confidence Vote
Michel Barnier's government, appointed by Emmanuel Macron after legislative election losses, collapsed on Wednesday following a no-confidence vote in the French National Assembly, becoming the shortest-lived government in the Fifth Republic and leaving France without a budget at the end of the year.
Progress
40% Bias Score

Missing Protein Segment Linked to 80% of Autism Cases
A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.

Missing Protein Segment Linked to 80% of Autism Cases
A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.
Progress
32% Bias Score

French PM Barnier Resigns, Triggering Political Crisis
French Prime Minister Michel Barnier resigned today after a no-confidence vote, leaving France without a budget and facing political instability; President Macron must find a replacement quickly to avoid economic crisis.

French PM Barnier Resigns, Triggering Political Crisis
French Prime Minister Michel Barnier resigned today after a no-confidence vote, leaving France without a budget and facing political instability; President Macron must find a replacement quickly to avoid economic crisis.
Progress
48% Bias Score

Terremoto de magnitud 7,0 sacude el norte de California
Un terremoto de magnitud 7,0 sacudió el norte de California el jueves a las 10:44 am, provocando una breve alerta de tsunami que luego fue cancelada; no se reportaron daños importantes.

Terremoto de magnitud 7,0 sacude el norte de California
Un terremoto de magnitud 7,0 sacudió el norte de California el jueves a las 10:44 am, provocando una breve alerta de tsunami que luego fue cancelada; no se reportaron daños importantes.
Progress
28% Bias Score