Domain: elpais.com

Spanish newspaper

El País is a Spanish-language daily newspaper in Spain. El País is based in the capital city of Madrid and it is owned by the Spanish media conglomerate PRISA.

Showing 6,565 to 6,576 of 7,046 results

elpais.com
🌐 85% Global Worthiness
News related image

Gene Therapy Shows Promise in Treating Fanconi Anemia

A Spanish-led team successfully used gene therapy to treat Fanconi anemia in nine children, achieving significant improvements and offering a safer alternative to bone marrow transplants.

Progress

16% Bias Score

elpais.com
🌐 85% Global Worthiness
News related image

Antibiotic Resistance: Latin American Scientists Offer Hope Amidst Global Crisis

Antibiotic resistance caused 1.27 million deaths in 2019, prompting research into new treatments like novel synthetic antibiotics in Chile and bacteriophage therapies in Uruguay and Colombia, facing challenges in funding and regulation.

Progress

24% Bias Score

elpais.com
🌐 85% Global Worthiness
News related image

Milei rallies global ultra-right at CPAC Buenos Aires

The Conservative Political Action Conference (CPAC) held its first meeting in Buenos Aires, Argentina, on Wednesday, concluding with a speech by President Javier Milei, who, alongside other prominent right-wing figures, criticized leftist leaders and promoted a global ultra-right movement. Hundreds ...

Progress

68% Bias Score

elpais.com
🌐 85% Global Worthiness
News related image

Captain Arrested for Rape, 15 Others Charged with Failing to Intervene

The captain of a migrant boat that arrived in Formentera on Saturday is accused of raping a 17-year-old female passenger; 15 other male passengers face charges for failing to help her.

Progress

60% Bias Score

elpais.com
🌐 85% Global Worthiness
News related image

Spain Unveils 100-Point Africa Strategy

Spain launched a new foreign policy strategy for Africa, outlining 100 measures for youth development, sustainable growth, and green energy, aiming for an equal partnership and addressing security and investment opportunities, while facing competition from other global powers.

Progress

48% Bias Score

elpais.com
🌐 85% Global Worthiness
News related image

Georgia: Violent Crackdown on Anti-EU Protests Sparks International Condemnation

The Georgian government violently suppressed protests against its decision to halt EU accession talks, leading to hundreds of arrests, dozens of injuries, and international condemnation, raising concerns about democratic backsliding and prompting threats of sanctions from the US and EU.

Progress

44% Bias Score

elpais.com
🌐 85% Global Worthiness
News related image

Yamal Orchestrates Barcelona's 5-1 Victory Over Mallorca

Lamine Yamal, a 17-year-old FC Barcelona winger, orchestrated their 5-1 victory over Mallorca on Tuesday, creating three goals and initiating another, despite not scoring himself; Barcelona has won all 16 matches where he started.

Progress

48% Bias Score

elpais.com
🌐 85% Global Worthiness
News related image

Colombian Finance Minister Resigns Amid Corruption Scandal

Ricardo Bonilla resigned as Colombia's Minister of Finance following accusations of contract redirection for political gain, leaving the government facing budgetary challenges and raising questions about President Petro's approach to corruption within his administration.

Progress

52% Bias Score

elpais.com
🌐 85% Global Worthiness
News related image

French Government Collapses After No-Confidence Vote

Michel Barnier's government, appointed by Emmanuel Macron after legislative election losses, collapsed on Wednesday following a no-confidence vote in the French National Assembly, becoming the shortest-lived government in the Fifth Republic and leaving France without a budget at the end of the year.

Progress

40% Bias Score

Peace, Justice, and Strong Institutions
elpais.com
🌐 85% Global Worthiness
News related image

Missing Protein Segment Linked to 80% of Autism Cases

A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.

Progress

32% Bias Score

Good Health and Well-being
elpais.com
🌐 85% Global Worthiness
News related image

French PM Barnier Resigns, Triggering Political Crisis

French Prime Minister Michel Barnier resigned today after a no-confidence vote, leaving France without a budget and facing political instability; President Macron must find a replacement quickly to avoid economic crisis.

Progress

48% Bias Score

elpais.com
🌐 85% Global Worthiness
News related image

Terremoto de magnitud 7,0 sacude el norte de California

Un terremoto de magnitud 7,0 sacudió el norte de California el jueves a las 10:44 am, provocando una breve alerta de tsunami que luego fue cancelada; no se reportaron daños importantes.

Progress

28% Bias Score

Sustainable Cities and Communities

Showing 6,565 to 6,576 of 7,046 results