Showing 4,033 to 4,044 of 4,304 results


Vaping Impairs Blood Vessel Function, Study Shows
A study shows vaping, with or without nicotine, immediately reduces blood flow velocity and oxygen saturation in vapers, raising concerns about cardiovascular health.
Vaping Impairs Blood Vessel Function, Study Shows
A study shows vaping, with or without nicotine, immediately reduces blood flow velocity and oxygen saturation in vapers, raising concerns about cardiovascular health.
Progress
40% Bias Score


Antibiotic Resistance: Latin American Scientists Offer Hope Amidst Global Crisis
Antibiotic resistance caused 1.27 million deaths in 2019, prompting research into new treatments like novel synthetic antibiotics in Chile and bacteriophage therapies in Uruguay and Colombia, facing challenges in funding and regulation.
Antibiotic Resistance: Latin American Scientists Offer Hope Amidst Global Crisis
Antibiotic resistance caused 1.27 million deaths in 2019, prompting research into new treatments like novel synthetic antibiotics in Chile and bacteriophage therapies in Uruguay and Colombia, facing challenges in funding and regulation.
Progress
24% Bias Score


Fructose Indirectly Fuels Cancer Growth via Liver Lipid Production
A study published in Nature reveals that while cancer cells don't directly use fructose, it fuels tumor growth by causing the liver to produce lipids essential for cancer cell division, creating a potential new therapeutic target.
Fructose Indirectly Fuels Cancer Growth via Liver Lipid Production
A study published in Nature reveals that while cancer cells don't directly use fructose, it fuels tumor growth by causing the liver to produce lipids essential for cancer cell division, creating a potential new therapeutic target.
Progress
32% Bias Score


Global Rise in Childhood Type 1 Diabetes: Finland Shows Highest Rate
Global childhood type 1 diabetes cases increased by 40% since 1990, reaching over 222,000 in 2021; Finland had the highest rate (70/100,000), while mortality fell to 4,280 deaths, highlighting a complex interplay of factors including access to healthcare and environmental influences.
Global Rise in Childhood Type 1 Diabetes: Finland Shows Highest Rate
Global childhood type 1 diabetes cases increased by 40% since 1990, reaching over 222,000 in 2021; Finland had the highest rate (70/100,000), while mortality fell to 4,280 deaths, highlighting a complex interplay of factors including access to healthcare and environmental influences.
Progress
20% Bias Score


7.0 Magnitude Earthquake Strikes off Northern California Coast
A 7.0 magnitude earthquake struck off the coast of Northern California at 10:44 a.m. on Thursday, prompting a tsunami warning for 5.3 million people that was later canceled; while there were evacuations and reports of damage, no major injuries have been reported.
7.0 Magnitude Earthquake Strikes off Northern California Coast
A 7.0 magnitude earthquake struck off the coast of Northern California at 10:44 a.m. on Thursday, prompting a tsunami warning for 5.3 million people that was later canceled; while there were evacuations and reports of damage, no major injuries have been reported.
Progress
16% Bias Score


Health Risks of Reusing Single-Use Plastics
Reusing single-use plastics like water bottles and takeout containers exposes individuals to potentially harmful chemicals and microplastics; experts recommend avoiding this practice, particularly heating plastics, and switching to safer alternatives like glass or metal.
Health Risks of Reusing Single-Use Plastics
Reusing single-use plastics like water bottles and takeout containers exposes individuals to potentially harmful chemicals and microplastics; experts recommend avoiding this practice, particularly heating plastics, and switching to safer alternatives like glass or metal.
Progress
52% Bias Score

Gene Therapy Shows Promise in Treating Fanconi Anemia
A Spanish-led team successfully used gene therapy to treat Fanconi anemia in nine children, achieving significant improvements and offering a safer alternative to bone marrow transplants.

Gene Therapy Shows Promise in Treating Fanconi Anemia
A Spanish-led team successfully used gene therapy to treat Fanconi anemia in nine children, achieving significant improvements and offering a safer alternative to bone marrow transplants.
Progress
16% Bias Score

Missing Protein Segment Linked to 80% of Autism Cases
A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.

Missing Protein Segment Linked to 80% of Autism Cases
A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.
Progress
32% Bias Score

Trump Nominates Space Tourist Isaacman to Lead NASA
Donald Trump nominated Jared Isaacman, a 41-year-old billionaire and experienced private space tourist, to lead NASA, aiming to revitalize the agency and accelerate the Artemis lunar program amid challenges posed by China's ambitious space goals and internal issues within NASA.

Trump Nominates Space Tourist Isaacman to Lead NASA
Donald Trump nominated Jared Isaacman, a 41-year-old billionaire and experienced private space tourist, to lead NASA, aiming to revitalize the agency and accelerate the Artemis lunar program amid challenges posed by China's ambitious space goals and internal issues within NASA.
Progress
64% Bias Score

Belly Fat Linked to Early Alzheimer's Biomarkers
Research reveals a strong correlation between increased visceral abdominal fat and the presence of amyloid plaques and tau tangles in the brain, key Alzheimer's biomarkers, even before cognitive decline is evident; reducing belly fat may be a crucial preventative strategy.

Belly Fat Linked to Early Alzheimer's Biomarkers
Research reveals a strong correlation between increased visceral abdominal fat and the presence of amyloid plaques and tau tangles in the brain, key Alzheimer's biomarkers, even before cognitive decline is evident; reducing belly fat may be a crucial preventative strategy.
Progress
44% Bias Score

Terremoto de magnitud 7,0 sacude el norte de California
Un terremoto de magnitud 7,0 sacudió el norte de California el jueves a las 10:44 am, provocando una breve alerta de tsunami que luego fue cancelada; no se reportaron daños importantes.

Terremoto de magnitud 7,0 sacude el norte de California
Un terremoto de magnitud 7,0 sacudió el norte de California el jueves a las 10:44 am, provocando una breve alerta de tsunami que luego fue cancelada; no se reportaron daños importantes.
Progress
28% Bias Score

"Extended Space Mission Due to Starliner Malfunction Delays Astronauts' Return Until February 2024"
"Due to technical malfunctions, astronauts Butch Wilmore and Suni Williams's week-long test flight aboard Boeing's Starliner capsule has extended to six months, delaying their return to Earth until February 2024, prompting a thorough investigation and impacting NASA's spaceflight operations."

"Extended Space Mission Due to Starliner Malfunction Delays Astronauts' Return Until February 2024"
"Due to technical malfunctions, astronauts Butch Wilmore and Suni Williams's week-long test flight aboard Boeing's Starliner capsule has extended to six months, delaying their return to Earth until February 2024, prompting a thorough investigation and impacting NASA's spaceflight operations."
Progress
44% Bias Score
Showing 4,033 to 4,044 of 4,304 results