Tag #Science

Showing 4,453 to 4,464 of 4,724 results

arabic.cnn.com
🌐 85% Global Worthiness
News related image

Vaping Impairs Blood Vessel Function, Study Shows

A study shows vaping, with or without nicotine, immediately reduces blood flow velocity and oxygen saturation in vapers, raising concerns about cardiovascular health.

Progress

40% Bias Score

Good Health and Well-being
elpais.com
🌐 85% Global Worthiness
News related image

Antibiotic Resistance: Latin American Scientists Offer Hope Amidst Global Crisis

Antibiotic resistance caused 1.27 million deaths in 2019, prompting research into new treatments like novel synthetic antibiotics in Chile and bacteriophage therapies in Uruguay and Colombia, facing challenges in funding and regulation.

Progress

24% Bias Score

repubblica.it
🌐 85% Global Worthiness
News related image

Fructose Indirectly Fuels Cancer Growth via Liver Lipid Production

A study published in Nature reveals that while cancer cells don't directly use fructose, it fuels tumor growth by causing the liver to produce lipids essential for cancer cell division, creating a potential new therapeutic target.

Progress

32% Bias Score

Good Health and Well-being
arabic.euronews.com
🌐 85% Global Worthiness
News related image

Global Rise in Childhood Type 1 Diabetes: Finland Shows Highest Rate

Global childhood type 1 diabetes cases increased by 40% since 1990, reaching over 222,000 in 2021; Finland had the highest rate (70/100,000), while mortality fell to 4,280 deaths, highlighting a complex interplay of factors including access to healthcare and environmental influences.

Progress

20% Bias Score

Good Health and Well-being
theglobeandmail.com
🌐 85% Global Worthiness
News related image

7.0 Magnitude Earthquake Strikes off Northern California Coast

A 7.0 magnitude earthquake struck off the coast of Northern California at 10:44 a.m. on Thursday, prompting a tsunami warning for 5.3 million people that was later canceled; while there were evacuations and reports of damage, no major injuries have been reported.

Progress

16% Bias Score

Sustainable Cities and Communities
smh.com.au
🌐 85% Global Worthiness
News related image

Health Risks of Reusing Single-Use Plastics

Reusing single-use plastics like water bottles and takeout containers exposes individuals to potentially harmful chemicals and microplastics; experts recommend avoiding this practice, particularly heating plastics, and switching to safer alternatives like glass or metal.

Progress

52% Bias Score

Good Health and Well-being
elpais.com
🌐 85% Global Worthiness
News related image

Gene Therapy Shows Promise in Treating Fanconi Anemia

A Spanish-led team successfully used gene therapy to treat Fanconi anemia in nine children, achieving significant improvements and offering a safer alternative to bone marrow transplants.

Progress

16% Bias Score

elpais.com
🌐 85% Global Worthiness
News related image

Missing Protein Segment Linked to 80% of Autism Cases

A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.

Progress

32% Bias Score

Good Health and Well-being
pda.kp.ru
🌐 85% Global Worthiness
News related image

Trump Nominates Space Tourist Isaacman to Lead NASA

Donald Trump nominated Jared Isaacman, a 41-year-old billionaire and experienced private space tourist, to lead NASA, aiming to revitalize the agency and accelerate the Artemis lunar program amid challenges posed by China's ambitious space goals and internal issues within NASA.

Progress

64% Bias Score

edition.cnn.com
🌐 85% Global Worthiness
News related image

Belly Fat Linked to Early Alzheimer's Biomarkers

Research reveals a strong correlation between increased visceral abdominal fat and the presence of amyloid plaques and tau tangles in the brain, key Alzheimer's biomarkers, even before cognitive decline is evident; reducing belly fat may be a crucial preventative strategy.

Progress

44% Bias Score

Good Health and Well-being
elpais.com
🌐 85% Global Worthiness
News related image

Terremoto de magnitud 7,0 sacude el norte de California

Un terremoto de magnitud 7,0 sacudió el norte de California el jueves a las 10:44 am, provocando una breve alerta de tsunami que luego fue cancelada; no se reportaron daños importantes.

Progress

28% Bias Score

Sustainable Cities and Communities
abcnews.go.com
🌐 85% Global Worthiness
News related image

"Extended Space Mission Due to Starliner Malfunction Delays Astronauts' Return Until February 2024"

"Due to technical malfunctions, astronauts Butch Wilmore and Suni Williams's week-long test flight aboard Boeing's Starliner capsule has extended to six months, delaying their return to Earth until February 2024, prompting a thorough investigation and impacting NASA's spaceflight operations."

Progress

44% Bias Score

Good Health and Well-being

Showing 4,453 to 4,464 of 4,724 results