Calendar

December 2024

M
T
W
T
F
S
S

Showing 265 to 276 of 1,009 results

elpais.com
🌐 85% Global Worthiness
News related image

Missing Protein Segment Linked to 80% of Autism Cases

A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.

Progress

32% Bias Score

Good Health and Well-being
cnbc.com
🌐 85% Global Worthiness
News related image

South Korea President Faces Impeachment Following Controversial Martial Law Declaration

South Korean President Yoon Suk Yeol faces impeachment after declaring martial law for six hours on Tuesday, prompting immediate backlash and the submission of impeachment articles by the opposition, which holds a parliamentary majority.

Progress

56% Bias Score

Peace, Justice, and Strong Institutions
africa.chinadaily.com.cn
🌐 85% Global Worthiness
News related image

Formula One's Global Popularity Surge Driven by Female Fans and New Sponsors

Formula One viewership increased by 50 million globally since 2021, with female fans aged 16-24 representing the fastest-growing demographic; this is attracting new sponsors and boosting revenue by 56% compared to pre-pandemic levels.

Progress

44% Bias Score

elpais.com
🌐 85% Global Worthiness
News related image

French Government Collapses After No-Confidence Vote

Michel Barnier's government, appointed by Emmanuel Macron after legislative election losses, collapsed on Wednesday following a no-confidence vote in the French National Assembly, becoming the shortest-lived government in the Fifth Republic and leaving France without a budget at the end of the year.

Progress

40% Bias Score

Peace, Justice, and Strong Institutions
africa.chinadaily.com.cn
🌐 85% Global Worthiness
News related image

Syrian Army Kills 300 HTS Militants in Hama Amidst Aleppo Chaos

Syrian army forces clashed with Hayat Tahrir al-Sham (HTS) rebels in Hama province, killing at least 300 militants and destroying 25 drones, while Aleppo faces post-rebel takeover chaos, including theft and communication outages.

Progress

52% Bias Score

africa.chinadaily.com.cn
🌐 85% Global Worthiness
News related image

100,000th China-Europe Freight Train Arrives in Duisburg

The 100,000th China-Europe freight train, carrying electronics, industrial parts, and household appliances, arrived in Duisburg, Germany on Tuesday, marking a milestone in the rail link between Chongqing and Duisburg, boosting trade and creating over 20,000 jobs in Duisburg since 2016.

Progress

48% Bias Score

cnbc.com
🌐 85% Global Worthiness
News related image

Bitcoin Surges Past $100,000 on Trump's SEC Nominee Announcement

Bitcoin price exceeded $100,000 for the first time on Wednesday, fueled by President-elect Trump's SEC chair nomination and increasing institutional adoption, marking a significant milestone for the cryptocurrency.

Progress

56% Bias Score

elpais.com
🌐 85% Global Worthiness
News related image

Captain Arrested for Rape, 15 Others Charged with Failing to Intervene

The captain of a migrant boat that arrived in Formentera on Saturday is accused of raping a 17-year-old female passenger; 15 other male passengers face charges for failing to help her.

Progress

60% Bias Score

africa.chinadaily.com.cn
🌐 85% Global Worthiness
News related image

Sino-Japanese Forum Emphasizes Cooperation Amidst Global Uncertainty

The 20th Beijing-Tokyo Forum, held in Tokyo on October 25-26, 2023, saw Chinese and Japanese officials reaffirm their commitment to strengthening bilateral ties, restart free trade agreement negotiations, and increase people-to-people exchanges to address global challenges and foster a more peaceful...

Progress

32% Bias Score

africa.chinadaily.com.cn
🌐 85% Global Worthiness
News related image

China Leads Global South in Redefining Development

China's economic rise and technological innovations are reshaping global development, challenging Western dominance and promoting inclusive growth, as highlighted in a new report by the Centre for International Knowledge on Development (CIKD).

Progress

64% Bias Score

smh.com.au
🌐 85% Global Worthiness
News related image

Australia Shifts Stance on Israeli-Palestinian Conflict, Questioning Two-State Solution

Australia reversed its long-standing policy by voting in favor of a UN resolution demanding Israel end its presence in occupied Palestinian territories, reflecting a global shift in perspective on the viability of the two-state solution to the Israeli-Palestinian conflict.

Progress

44% Bias Score

africa.chinadaily.com.cn
🌐 85% Global Worthiness
News related image

No-Confidence Vote Brings Down French Government

A no-confidence vote in the French National Assembly forced Prime Minister Michel Barnier's resignation Wednesday evening, after 331 deputies voted in favor, exceeding the 289 required, leaving France with less than one month to approve the 2025 budget amidst a projected economic slowdown and high d...

Progress

44% Bias Score

Showing 265 to 276 of 1,009 results