December 2024
January 2025
Missing Protein Segment Linked to 80% of Autism Cases
A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.
Missing Protein Segment Linked to 80% of Autism Cases
A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.
Progress
32% Bias Score
South Korea President Faces Impeachment Following Controversial Martial Law Declaration
South Korean President Yoon Suk Yeol faces impeachment after declaring martial law for six hours on Tuesday, prompting immediate backlash and the submission of impeachment articles by the opposition, which holds a parliamentary majority.
South Korea President Faces Impeachment Following Controversial Martial Law Declaration
South Korean President Yoon Suk Yeol faces impeachment after declaring martial law for six hours on Tuesday, prompting immediate backlash and the submission of impeachment articles by the opposition, which holds a parliamentary majority.
Progress
56% Bias Score
Formula One's Global Popularity Surge Driven by Female Fans and New Sponsors
Formula One viewership increased by 50 million globally since 2021, with female fans aged 16-24 representing the fastest-growing demographic; this is attracting new sponsors and boosting revenue by 56% compared to pre-pandemic levels.
Formula One's Global Popularity Surge Driven by Female Fans and New Sponsors
Formula One viewership increased by 50 million globally since 2021, with female fans aged 16-24 representing the fastest-growing demographic; this is attracting new sponsors and boosting revenue by 56% compared to pre-pandemic levels.
Progress
44% Bias Score
French Government Collapses After No-Confidence Vote
Michel Barnier's government, appointed by Emmanuel Macron after legislative election losses, collapsed on Wednesday following a no-confidence vote in the French National Assembly, becoming the shortest-lived government in the Fifth Republic and leaving France without a budget at the end of the year.
French Government Collapses After No-Confidence Vote
Michel Barnier's government, appointed by Emmanuel Macron after legislative election losses, collapsed on Wednesday following a no-confidence vote in the French National Assembly, becoming the shortest-lived government in the Fifth Republic and leaving France without a budget at the end of the year.
Progress
40% Bias Score
Syrian Army Kills 300 HTS Militants in Hama Amidst Aleppo Chaos
Syrian army forces clashed with Hayat Tahrir al-Sham (HTS) rebels in Hama province, killing at least 300 militants and destroying 25 drones, while Aleppo faces post-rebel takeover chaos, including theft and communication outages.
Syrian Army Kills 300 HTS Militants in Hama Amidst Aleppo Chaos
Syrian army forces clashed with Hayat Tahrir al-Sham (HTS) rebels in Hama province, killing at least 300 militants and destroying 25 drones, while Aleppo faces post-rebel takeover chaos, including theft and communication outages.
Progress
52% Bias Score
100,000th China-Europe Freight Train Arrives in Duisburg
The 100,000th China-Europe freight train, carrying electronics, industrial parts, and household appliances, arrived in Duisburg, Germany on Tuesday, marking a milestone in the rail link between Chongqing and Duisburg, boosting trade and creating over 20,000 jobs in Duisburg since 2016.
100,000th China-Europe Freight Train Arrives in Duisburg
The 100,000th China-Europe freight train, carrying electronics, industrial parts, and household appliances, arrived in Duisburg, Germany on Tuesday, marking a milestone in the rail link between Chongqing and Duisburg, boosting trade and creating over 20,000 jobs in Duisburg since 2016.
Progress
48% Bias Score
Bitcoin Surges Past $100,000 on Trump's SEC Nominee Announcement
Bitcoin price exceeded $100,000 for the first time on Wednesday, fueled by President-elect Trump's SEC chair nomination and increasing institutional adoption, marking a significant milestone for the cryptocurrency.
Bitcoin Surges Past $100,000 on Trump's SEC Nominee Announcement
Bitcoin price exceeded $100,000 for the first time on Wednesday, fueled by President-elect Trump's SEC chair nomination and increasing institutional adoption, marking a significant milestone for the cryptocurrency.
Progress
56% Bias Score
Captain Arrested for Rape, 15 Others Charged with Failing to Intervene
The captain of a migrant boat that arrived in Formentera on Saturday is accused of raping a 17-year-old female passenger; 15 other male passengers face charges for failing to help her.
Captain Arrested for Rape, 15 Others Charged with Failing to Intervene
The captain of a migrant boat that arrived in Formentera on Saturday is accused of raping a 17-year-old female passenger; 15 other male passengers face charges for failing to help her.
Progress
60% Bias Score
Sino-Japanese Forum Emphasizes Cooperation Amidst Global Uncertainty
The 20th Beijing-Tokyo Forum, held in Tokyo on October 25-26, 2023, saw Chinese and Japanese officials reaffirm their commitment to strengthening bilateral ties, restart free trade agreement negotiations, and increase people-to-people exchanges to address global challenges and foster a more peaceful...
Sino-Japanese Forum Emphasizes Cooperation Amidst Global Uncertainty
The 20th Beijing-Tokyo Forum, held in Tokyo on October 25-26, 2023, saw Chinese and Japanese officials reaffirm their commitment to strengthening bilateral ties, restart free trade agreement negotiations, and increase people-to-people exchanges to address global challenges and foster a more peaceful...
Progress
32% Bias Score
China Leads Global South in Redefining Development
China's economic rise and technological innovations are reshaping global development, challenging Western dominance and promoting inclusive growth, as highlighted in a new report by the Centre for International Knowledge on Development (CIKD).
China Leads Global South in Redefining Development
China's economic rise and technological innovations are reshaping global development, challenging Western dominance and promoting inclusive growth, as highlighted in a new report by the Centre for International Knowledge on Development (CIKD).
Progress
64% Bias Score
Australia Shifts Stance on Israeli-Palestinian Conflict, Questioning Two-State Solution
Australia reversed its long-standing policy by voting in favor of a UN resolution demanding Israel end its presence in occupied Palestinian territories, reflecting a global shift in perspective on the viability of the two-state solution to the Israeli-Palestinian conflict.
Australia Shifts Stance on Israeli-Palestinian Conflict, Questioning Two-State Solution
Australia reversed its long-standing policy by voting in favor of a UN resolution demanding Israel end its presence in occupied Palestinian territories, reflecting a global shift in perspective on the viability of the two-state solution to the Israeli-Palestinian conflict.
Progress
44% Bias Score
No-Confidence Vote Brings Down French Government
A no-confidence vote in the French National Assembly forced Prime Minister Michel Barnier's resignation Wednesday evening, after 331 deputies voted in favor, exceeding the 289 required, leaving France with less than one month to approve the 2025 budget amidst a projected economic slowdown and high d...
No-Confidence Vote Brings Down French Government
A no-confidence vote in the French National Assembly forced Prime Minister Michel Barnier's resignation Wednesday evening, after 331 deputies voted in favor, exceeding the 289 required, leaving France with less than one month to approve the 2025 budget amidst a projected economic slowdown and high d...
Progress
44% Bias Score