Oldest Homo Sapiens DNA Reveals Interbreeding with Neanderthals
A study published in Nature reveals the oldest known Homo sapiens DNA, sequenced from 45,000-year-old remains in Germany, showing interbreeding with Neanderthals around 1,500 years prior and that some lineages died out.
Oldest Homo Sapiens DNA Reveals Interbreeding with Neanderthals
A study published in Nature reveals the oldest known Homo sapiens DNA, sequenced from 45,000-year-old remains in Germany, showing interbreeding with Neanderthals around 1,500 years prior and that some lineages died out.
Progress
40% Bias Score
Genetic Data Enhances Financial Planning for Retirement
US financial advisors are using clients' genetic and health data to create personalized financial plans and longevity risk assessments, improving retirement planning by offering more precise predictions of lifespan and healthcare needs, leading to better resource allocation and financial security.
Genetic Data Enhances Financial Planning for Retirement
US financial advisors are using clients' genetic and health data to create personalized financial plans and longevity risk assessments, improving retirement planning by offering more precise predictions of lifespan and healthcare needs, leading to better resource allocation and financial security.
Progress
36% Bias Score
Genetic Link Found Between Menstrual Pain and Depression
A study of nearly 600,000 individuals found a genetic link between menstrual pain and depression, with those suffering from depression 51% more prone to menstrual pain, and those with insomnia 3 times more likely.
Genetic Link Found Between Menstrual Pain and Depression
A study of nearly 600,000 individuals found a genetic link between menstrual pain and depression, with those suffering from depression 51% more prone to menstrual pain, and those with insomnia 3 times more likely.
Progress
44% Bias Score
Pompeii DNA Study Reveals Surprising Truths
DNA analysis of Pompeii victims challenges earlier assumptions about gender and family relationships, providing new insights into the city's population.
Pompeii DNA Study Reveals Surprising Truths
DNA analysis of Pompeii victims challenges earlier assumptions about gender and family relationships, providing new insights into the city's population.
Progress
0% Bias Score
Wonder Theory: Ancient Mysteries & Modern Discoveries
New discoveries about Pompeii, ancient writing, an emperor penguin, mummified remains, and Planet Nine.
Wonder Theory: Ancient Mysteries & Modern Discoveries
New discoveries about Pompeii, ancient writing, an emperor penguin, mummified remains, and Planet Nine.
Progress
0% Bias Score
Pompeii's DNA Secrets
Ancient DNA from Pompeii challenges previous assumptions about family and gender roles, revealing a diverse and cosmopolitan population.
Pompeii's DNA Secrets
Ancient DNA from Pompeii challenges previous assumptions about family and gender roles, revealing a diverse and cosmopolitan population.
Progress
0% Bias Score
Oldest Homo Sapiens DNA Reveals Details of Neanderthal Interbreeding
Scientists discovered the oldest known Homo sapiens DNA in Germany, revealing interbreeding with Neanderthals around 45,000 years ago and challenging prior assumptions about the timing and location of this interspecies interaction.
Oldest Homo Sapiens DNA Reveals Details of Neanderthal Interbreeding
Scientists discovered the oldest known Homo sapiens DNA in Germany, revealing interbreeding with Neanderthals around 45,000 years ago and challenging prior assumptions about the timing and location of this interspecies interaction.
Progress
16% Bias Score
Missing Protein Segment Linked to 80% of Autism Cases
A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.
Missing Protein Segment Linked to 80% of Autism Cases
A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.
Progress
32% Bias Score
Embryo Selection: Ethics and Global Trends
Analysis of the ethical and societal impact of embryo selection based on genetic predictions, examining the practices of Heliospect Genomics and the global trends in reproductive technologies.
Embryo Selection: Ethics and Global Trends
Analysis of the ethical and societal impact of embryo selection based on genetic predictions, examining the practices of Heliospect Genomics and the global trends in reproductive technologies.
Progress
0% Bias Score
Embryo Selection: Ethical Concerns and Global Trends
A US startup offers embryo selection based on various traits, sparking ethical debates and raising concerns about the use of genetic data. The practice is spreading due to technological advancements and the increasing use of IVF.
Embryo Selection: Ethical Concerns and Global Trends
A US startup offers embryo selection based on various traits, sparking ethical debates and raising concerns about the use of genetic data. The practice is spreading due to technological advancements and the increasing use of IVF.
Progress
0% Bias Score
Genetic and Lifestyle Factors in Cognitive Aging
A study reveals that about half of the variability in cognitive abilities in old age is evident by age 11, but lifestyle choices significantly impact brain health and aging.
Genetic and Lifestyle Factors in Cognitive Aging
A study reveals that about half of the variability in cognitive abilities in old age is evident by age 11, but lifestyle choices significantly impact brain health and aging.
Progress
0% Bias Score
Pompeii's DNA: Unveiling a Cosmopolitan Past
Ancient DNA from Pompeii challenges previous assumptions about family relationships and demographics, revealing a diverse population with connections throughout the Roman Empire.
Pompeii's DNA: Unveiling a Cosmopolitan Past
Ancient DNA from Pompeii challenges previous assumptions about family relationships and demographics, revealing a diverse population with connections throughout the Roman Empire.
Progress
0% Bias Score