Tag #Genetics

edition.cnn.com
🌐 90% Global Worthiness
News related image

Oldest Homo Sapiens DNA Reveals Interbreeding with Neanderthals

A study published in Nature reveals the oldest known Homo sapiens DNA, sequenced from 45,000-year-old remains in Germany, showing interbreeding with Neanderthals around 1,500 years prior and that some lineages died out.

Progress

40% Bias Score

Good Health and Well-being
theglobeandmail.com
🌐 75% Global Worthiness
News related image

Genetic Data Enhances Financial Planning for Retirement

US financial advisors are using clients' genetic and health data to create personalized financial plans and longevity risk assessments, improving retirement planning by offering more precise predictions of lifespan and healthcare needs, leading to better resource allocation and financial security.

Progress

36% Bias Score

Good Health and Well-being
dw.com
🌐 75% Global Worthiness
News related image

Genetic Link Found Between Menstrual Pain and Depression

A study of nearly 600,000 individuals found a genetic link between menstrual pain and depression, with those suffering from depression 51% more prone to menstrual pain, and those with insomnia 3 times more likely.

Progress

44% Bias Score

Good Health and Well-being
jpost.com
🌐 % Global Worthiness
News related image

Pompeii DNA Study Reveals Surprising Truths

DNA analysis of Pompeii victims challenges earlier assumptions about gender and family relationships, providing new insights into the city's population.

Progress

0% Bias Score

cnn.com
🌐 % Global Worthiness
News related image

Wonder Theory: Ancient Mysteries & Modern Discoveries

New discoveries about Pompeii, ancient writing, an emperor penguin, mummified remains, and Planet Nine.

Progress

0% Bias Score

cnnespanol.cnn.com
🌐 % Global Worthiness
News related image

Pompeii's DNA Secrets

Ancient DNA from Pompeii challenges previous assumptions about family and gender roles, revealing a diverse and cosmopolitan population.

Progress

0% Bias Score

cnn.com
🌐 90% Global Worthiness
News related image

Oldest Homo Sapiens DNA Reveals Details of Neanderthal Interbreeding

Scientists discovered the oldest known Homo sapiens DNA in Germany, revealing interbreeding with Neanderthals around 45,000 years ago and challenging prior assumptions about the timing and location of this interspecies interaction.

Progress

16% Bias Score

No Poverty
elpais.com
🌐 85% Global Worthiness
News related image

Missing Protein Segment Linked to 80% of Autism Cases

A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.

Progress

32% Bias Score

Good Health and Well-being
lexpansion.lexpress.fr
🌐 % Global Worthiness
News related image

Embryo Selection: Ethics and Global Trends

Analysis of the ethical and societal impact of embryo selection based on genetic predictions, examining the practices of Heliospect Genomics and the global trends in reproductive technologies.

Progress

0% Bias Score

lentreprise.lexpress.fr
🌐 % Global Worthiness
News related image

Embryo Selection: Ethical Concerns and Global Trends

A US startup offers embryo selection based on various traits, sparking ethical debates and raising concerns about the use of genetic data. The practice is spreading due to technological advancements and the increasing use of IVF.

Progress

0% Bias Score

mk.ru
🌐 % Global Worthiness
News related image

Genetic and Lifestyle Factors in Cognitive Aging

A study reveals that about half of the variability in cognitive abilities in old age is evident by age 11, but lifestyle choices significantly impact brain health and aging.

Progress

0% Bias Score

cnnespanol.cnn.com
🌐 % Global Worthiness
News related image

Pompeii's DNA: Unveiling a Cosmopolitan Past

Ancient DNA from Pompeii challenges previous assumptions about family relationships and demographics, revealing a diverse population with connections throughout the Roman Empire.

Progress

0% Bias Score