Glioblastoma Death Highlights Projected 75% Increase in Cases by 2050
Fox News commentator Dr. Kelly Powers, 45, died from glioblastoma, a brain cancer projected to increase by 75 percent by 2050 due to pollution and chemical exposure; despite treatments, she passed away last week leaving behind a young son.
Glioblastoma Death Highlights Projected 75% Increase in Cases by 2050
Fox News commentator Dr. Kelly Powers, 45, died from glioblastoma, a brain cancer projected to increase by 75 percent by 2050 due to pollution and chemical exposure; despite treatments, she passed away last week leaving behind a young son.
Progress
40% Bias Score
California Dairy Expands Raw Milk Recall After Bird Flu Detection
Raw Farm in Fresno, California, expanded its recall of raw milk and cream products after bird flu virus was found in multiple samples, halting production and prompting a state quarantine; officials encourage consumers not to consume affected products.
California Dairy Expands Raw Milk Recall After Bird Flu Detection
Raw Farm in Fresno, California, expanded its recall of raw milk and cream products after bird flu virus was found in multiple samples, halting production and prompting a state quarantine; officials encourage consumers not to consume affected products.
Progress
48% Bias Score
Fentanyl Crisis: San Francisco's Union Square Exemplifies US Opioid Epidemic
The transformation of San Francisco's Union Square from a tourist destination to a fentanyl crisis zone exemplifies the devastating US opioid epidemic, claiming over 400,000 lives since 2010, with a complex supply chain involving China, Mexico, and lax US import regulations.
Fentanyl Crisis: San Francisco's Union Square Exemplifies US Opioid Epidemic
The transformation of San Francisco's Union Square from a tourist destination to a fentanyl crisis zone exemplifies the devastating US opioid epidemic, claiming over 400,000 lives since 2010, with a complex supply chain involving China, Mexico, and lax US import regulations.
Progress
56% Bias Score
Antibiotic Resistance: Latin American Scientists Offer Hope Amidst Global Crisis
Antibiotic resistance caused 1.27 million deaths in 2019, prompting research into new treatments like novel synthetic antibiotics in Chile and bacteriophage therapies in Uruguay and Colombia, facing challenges in funding and regulation.
Antibiotic Resistance: Latin American Scientists Offer Hope Amidst Global Crisis
Antibiotic resistance caused 1.27 million deaths in 2019, prompting research into new treatments like novel synthetic antibiotics in Chile and bacteriophage therapies in Uruguay and Colombia, facing challenges in funding and regulation.
Progress
24% Bias Score
400 000 participants à des marathons chinois : un engouement national
Plus de 400 000 personnes ont participé à plus de 30 marathons et courses sur route en Chine les 2 et 3 novembre, reflétant un engouement national pour la santé et le sport, et stimulant l'économie.
400 000 participants à des marathons chinois : un engouement national
Plus de 400 000 personnes ont participé à plus de 30 marathons et courses sur route en Chine les 2 et 3 novembre, reflétant un engouement national pour la santé et le sport, et stimulant l'économie.
Progress
52% Bias Score
Fructose Indirectly Fuels Cancer Growth via Liver Lipid Production
A study published in Nature reveals that while cancer cells don't directly use fructose, it fuels tumor growth by causing the liver to produce lipids essential for cancer cell division, creating a potential new therapeutic target.
Fructose Indirectly Fuels Cancer Growth via Liver Lipid Production
A study published in Nature reveals that while cancer cells don't directly use fructose, it fuels tumor growth by causing the liver to produce lipids essential for cancer cell division, creating a potential new therapeutic target.
Progress
32% Bias Score
Brain Rot: A 230% Surge in 2024 Highlights Growing Mental Health Concerns
The term "Brain Rot," signifying mental decline from excessive online content consumption, surged 230% in 2024, fueled by Gen Z and Alpha on TikTok, raising concerns about cognitive function and mental well-being.
Brain Rot: A 230% Surge in 2024 Highlights Growing Mental Health Concerns
The term "Brain Rot," signifying mental decline from excessive online content consumption, surged 230% in 2024, fueled by Gen Z and Alpha on TikTok, raising concerns about cognitive function and mental well-being.
Progress
44% Bias Score
Vaping Impairs Blood Vessel Function, Study Shows
A study shows vaping, with or without nicotine, immediately reduces blood flow velocity and oxygen saturation in vapers, raising concerns about cardiovascular health.
Vaping Impairs Blood Vessel Function, Study Shows
A study shows vaping, with or without nicotine, immediately reduces blood flow velocity and oxygen saturation in vapers, raising concerns about cardiovascular health.
Progress
40% Bias Score
Gene Therapy Shows Promise in Treating Fanconi Anemia
A Spanish-led team successfully used gene therapy to treat Fanconi anemia in nine children, achieving significant improvements and offering a safer alternative to bone marrow transplants.
Gene Therapy Shows Promise in Treating Fanconi Anemia
A Spanish-led team successfully used gene therapy to treat Fanconi anemia in nine children, achieving significant improvements and offering a safer alternative to bone marrow transplants.
Progress
16% Bias Score
Missing Protein Segment Linked to 80% of Autism Cases
A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.
Missing Protein Segment Linked to 80% of Autism Cases
A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.
Progress
32% Bias Score
US Respiratory Illness Surge: H3N2 Influenza and RSV Hospitalizations Increase
The US is facing a surge in respiratory illnesses, particularly among young children, with increased hospitalizations for RSV and influenza (H3N2) straining pediatric hospital wards, and low vaccination rates exacerbating the problem.
US Respiratory Illness Surge: H3N2 Influenza and RSV Hospitalizations Increase
The US is facing a surge in respiratory illnesses, particularly among young children, with increased hospitalizations for RSV and influenza (H3N2) straining pediatric hospital wards, and low vaccination rates exacerbating the problem.
Progress
40% Bias Score
AI-powered CT Scans Reduce Mortality in Khabarovsk Hospital
An AI-powered CT scan service in a Khabarovsk hospital reduced mortality from cerebrovascular diseases by over 30% in four years, improving diagnostic accuracy to over 95% and enabling timely interventions as part of Russia's national healthcare project.
AI-powered CT Scans Reduce Mortality in Khabarovsk Hospital
An AI-powered CT scan service in a Khabarovsk hospital reduced mortality from cerebrovascular diseases by over 30% in four years, improving diagnostic accuracy to over 95% and enabling timely interventions as part of Russia's national healthcare project.
Progress
44% Bias Score