Tag #Health

dailymail.co.uk
🌐 85% Global Worthiness
News related image

Glioblastoma Death Highlights Projected 75% Increase in Cases by 2050

Fox News commentator Dr. Kelly Powers, 45, died from glioblastoma, a brain cancer projected to increase by 75 percent by 2050 due to pollution and chemical exposure; despite treatments, she passed away last week leaving behind a young son.

Progress

40% Bias Score

abcnews.go.com
🌐 85% Global Worthiness
News related image

California Dairy Expands Raw Milk Recall After Bird Flu Detection

Raw Farm in Fresno, California, expanded its recall of raw milk and cream products after bird flu virus was found in multiple samples, halting production and prompting a state quarantine; officials encourage consumers not to consume affected products.

Progress

48% Bias Score

lexpress.fr
🌐 85% Global Worthiness
News related image

Fentanyl Crisis: San Francisco's Union Square Exemplifies US Opioid Epidemic

The transformation of San Francisco's Union Square from a tourist destination to a fentanyl crisis zone exemplifies the devastating US opioid epidemic, claiming over 400,000 lives since 2010, with a complex supply chain involving China, Mexico, and lax US import regulations.

Progress

56% Bias Score

elpais.com
🌐 85% Global Worthiness
News related image

Antibiotic Resistance: Latin American Scientists Offer Hope Amidst Global Crisis

Antibiotic resistance caused 1.27 million deaths in 2019, prompting research into new treatments like novel synthetic antibiotics in Chile and bacteriophage therapies in Uruguay and Colombia, facing challenges in funding and regulation.

Progress

24% Bias Score

french.china.org.cn
🌐 85% Global Worthiness
News related image

400 000 participants à des marathons chinois : un engouement national

Plus de 400 000 personnes ont participé à plus de 30 marathons et courses sur route en Chine les 2 et 3 novembre, reflétant un engouement national pour la santé et le sport, et stimulant l'économie.

Progress

52% Bias Score

repubblica.it
🌐 85% Global Worthiness
News related image

Fructose Indirectly Fuels Cancer Growth via Liver Lipid Production

A study published in Nature reveals that while cancer cells don't directly use fructose, it fuels tumor growth by causing the liver to produce lipids essential for cancer cell division, creating a potential new therapeutic target.

Progress

32% Bias Score

Good Health and Well-being
forbes.com
🌐 85% Global Worthiness
News related image

Brain Rot: A 230% Surge in 2024 Highlights Growing Mental Health Concerns

The term "Brain Rot," signifying mental decline from excessive online content consumption, surged 230% in 2024, fueled by Gen Z and Alpha on TikTok, raising concerns about cognitive function and mental well-being.

Progress

44% Bias Score

arabic.cnn.com
🌐 85% Global Worthiness
News related image

Vaping Impairs Blood Vessel Function, Study Shows

A study shows vaping, with or without nicotine, immediately reduces blood flow velocity and oxygen saturation in vapers, raising concerns about cardiovascular health.

Progress

40% Bias Score

Good Health and Well-being
elpais.com
🌐 85% Global Worthiness
News related image

Gene Therapy Shows Promise in Treating Fanconi Anemia

A Spanish-led team successfully used gene therapy to treat Fanconi anemia in nine children, achieving significant improvements and offering a safer alternative to bone marrow transplants.

Progress

16% Bias Score

elpais.com
🌐 85% Global Worthiness
News related image

Missing Protein Segment Linked to 80% of Autism Cases

A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.

Progress

32% Bias Score

Good Health and Well-being
repubblica.it
🌐 85% Global Worthiness
News related image

US Respiratory Illness Surge: H3N2 Influenza and RSV Hospitalizations Increase

The US is facing a surge in respiratory illnesses, particularly among young children, with increased hospitalizations for RSV and influenza (H3N2) straining pediatric hospital wards, and low vaccination rates exacerbating the problem.

Progress

40% Bias Score

Good Health and Well-being
pda.hab.kp.ru
🌐 85% Global Worthiness
News related image

AI-powered CT Scans Reduce Mortality in Khabarovsk Hospital

An AI-powered CT scan service in a Khabarovsk hospital reduced mortality from cerebrovascular diseases by over 30% in four years, improving diagnostic accuracy to over 95% and enabling timely interventions as part of Russia's national healthcare project.

Progress

44% Bias Score

Good Health and Well-being