Non-Invasive Brain-Computer Interfaces Advance at MIT
MIT's Fluid Interfaces group is pioneering non-invasive brain-computer interface (BCI) technology using AI and EEG to decode human thought processes, initially for those with motor difficulties but with potential for broader applications in areas such as vehicle control and space exploration.
Non-Invasive Brain-Computer Interfaces Advance at MIT
MIT's Fluid Interfaces group is pioneering non-invasive brain-computer interface (BCI) technology using AI and EEG to decode human thought processes, initially for those with motor difficulties but with potential for broader applications in areas such as vehicle control and space exploration.
Progress
32% Bias Score
Ancient Mesopotamian Emotion Map Challenges Modern Understandings
A study analyzing one million words of ancient Mesopotamian texts (934-612 BC) reveals unique emotion localization, with happiness and love in the liver, anger in the thighs and feet, and suffering in the armpits, challenging modern understandings of emotional experience.
Ancient Mesopotamian Emotion Map Challenges Modern Understandings
A study analyzing one million words of ancient Mesopotamian texts (934-612 BC) reveals unique emotion localization, with happiness and love in the liver, anger in the thighs and feet, and suffering in the armpits, challenging modern understandings of emotional experience.
Progress
32% Bias Score
Chronic Complaining: Emotional and Physical Consequences
This article explores the detrimental effects of chronic complaining on mental and physical health, providing insights into its neurological basis and offering strategies for change.
Chronic Complaining: Emotional and Physical Consequences
This article explores the detrimental effects of chronic complaining on mental and physical health, providing insights into its neurological basis and offering strategies for change.
Progress
36% Bias Score
Hippocampal Neuron Reactivation and Memory Consolidation
A study reveals how the brain consolidates memories of stressful events, focusing on the role of hippocampal neurons and their reactivation during periods of rest.
Hippocampal Neuron Reactivation and Memory Consolidation
A study reveals how the brain consolidates memories of stressful events, focusing on the role of hippocampal neurons and their reactivation during periods of rest.
Progress
0% Bias Score
Neurological Basis of Shaking in Wet Mammals
Scientists discover the neurological mechanism behind the shaking behavior of wet mammals, linking it to ultrasensitive receptors and potentially to tickling sensations.
Neurological Basis of Shaking in Wet Mammals
Scientists discover the neurological mechanism behind the shaking behavior of wet mammals, linking it to ultrasensitive receptors and potentially to tickling sensations.
Progress
0% Bias Score
Re-evaluating Freud
A neuroscientist re-evaluates Sigmund Freud's work, highlighting its lasting impact on our understanding of the unconscious mind and early childhood development.
Re-evaluating Freud
A neuroscientist re-evaluates Sigmund Freud's work, highlighting its lasting impact on our understanding of the unconscious mind and early childhood development.
Progress
0% Bias Score
Brain's Dual Emotional Pathways Revealed by Patient X
Patient X, unable to consciously see due to severed brain connections, could still identify emotions in faces by feeling them via a direct pathway to the amygdala, demonstrating the existence of a faster, less accurate "low road" and a slower, more accurate "high road" in emotional processing.
Brain's Dual Emotional Pathways Revealed by Patient X
Patient X, unable to consciously see due to severed brain connections, could still identify emotions in faces by feeling them via a direct pathway to the amygdala, demonstrating the existence of a faster, less accurate "low road" and a slower, more accurate "high road" in emotional processing.
Progress
32% Bias Score
Missing Protein Segment Linked to 80% of Autism Cases
A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.
Missing Protein Segment Linked to 80% of Autism Cases
A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.
Progress
32% Bias Score
Death of Neuroscientist Yves Frégnac
Neuroscientist Yves Frégnac dies at 73; his contributions to the field and innovative approaches are highlighted.
Death of Neuroscientist Yves Frégnac
Neuroscientist Yves Frégnac dies at 73; his contributions to the field and innovative approaches are highlighted.
Progress
24% Bias Score
Liver-Brain Communication and Eating Habits
A new study reveals how the liver communicates with the brain to regulate eating patterns, offering potential therapeutic targets for weight management in individuals with disrupted circadian rhythms.
Liver-Brain Communication and Eating Habits
A new study reveals how the liver communicates with the brain to regulate eating patterns, offering potential therapeutic targets for weight management in individuals with disrupted circadian rhythms.
Progress
0% Bias Score
Brain Activity During Movie Viewing
A study used fMRI to map brain activity during movie viewing, identifying 24 networks involved and revealing differences based on content complexity and type.
Brain Activity During Movie Viewing
A study used fMRI to map brain activity during movie viewing, identifying 24 networks involved and revealing differences based on content complexity and type.
Progress
0% Bias Score