Tag #Neuroscience

forbes.com
🌐 85% Global Worthiness
News related image

Non-Invasive Brain-Computer Interfaces Advance at MIT

MIT's Fluid Interfaces group is pioneering non-invasive brain-computer interface (BCI) technology using AI and EEG to decode human thought processes, initially for those with motor difficulties but with potential for broader applications in areas such as vehicle control and space exploration.

Progress

32% Bias Score

Good Health and Well-being
dw.com
🌐 85% Global Worthiness
News related image

Ancient Mesopotamian Emotion Map Challenges Modern Understandings

A study analyzing one million words of ancient Mesopotamian texts (934-612 BC) reveals unique emotion localization, with happiness and love in the liver, anger in the thighs and feet, and suffering in the armpits, challenging modern understandings of emotional experience.

Progress

32% Bias Score

bbc.com
🌐 45% Global Worthiness
News related image

Chronic Complaining: Emotional and Physical Consequences

This article explores the detrimental effects of chronic complaining on mental and physical health, providing insights into its neurological basis and offering strategies for change.

Progress

36% Bias Score

Good Health and Well-being
lemonde.fr
🌐 % Global Worthiness
News related image

Hippocampal Neuron Reactivation and Memory Consolidation

A study reveals how the brain consolidates memories of stressful events, focusing on the role of hippocampal neurons and their reactivation during periods of rest.

Progress

0% Bias Score

dw.com
🌐 % Global Worthiness
News related image

Neurological Basis of Shaking in Wet Mammals

Scientists discover the neurological mechanism behind the shaking behavior of wet mammals, linking it to ultrasensitive receptors and potentially to tickling sensations.

Progress

0% Bias Score

telegraph.co.uk
🌐 % Global Worthiness
News related image

Re-evaluating Freud

A neuroscientist re-evaluates Sigmund Freud's work, highlighting its lasting impact on our understanding of the unconscious mind and early childhood development.

Progress

0% Bias Score

forbes.com
🌐 75% Global Worthiness
News related image

Brain's Dual Emotional Pathways Revealed by Patient X

Patient X, unable to consciously see due to severed brain connections, could still identify emotions in faces by feeling them via a direct pathway to the amygdala, demonstrating the existence of a faster, less accurate "low road" and a slower, more accurate "high road" in emotional processing.

Progress

32% Bias Score

Good Health and Well-being
elpais.com
🌐 85% Global Worthiness
News related image

Missing Protein Segment Linked to 80% of Autism Cases

A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.

Progress

32% Bias Score

Good Health and Well-being
lemonde.fr
🌐 25% Global Worthiness
News related image

Death of Neuroscientist Yves Frégnac

Neuroscientist Yves Frégnac dies at 73; his contributions to the field and innovative approaches are highlighted.

Progress

24% Bias Score

mk.ru
🌐 % Global Worthiness
News related image

Liver-Brain Communication and Eating Habits

A new study reveals how the liver communicates with the brain to regulate eating patterns, offering potential therapeutic targets for weight management in individuals with disrupted circadian rhythms.

Progress

0% Bias Score

welt.de
🌐 % Global Worthiness
News related image

Brain Activity During Movie Viewing

A study used fMRI to map brain activity during movie viewing, identifying 24 networks involved and revealing differences based on content complexity and type.

Progress

0% Bias Score