Record-Low Planetary Albedo Contributed to Unprecedented 2023-2024 Global Warming
A new study reveals that a record-low planetary albedo in 2023, primarily due to a decrease in low-level clouds, contributed significantly to the exceptionally warm temperatures of 2023 and 2024, exceeding many climate model predictions and potentially indicating a higher climate sensitivity than pr...
Record-Low Planetary Albedo Contributed to Unprecedented 2023-2024 Global Warming
A new study reveals that a record-low planetary albedo in 2023, primarily due to a decrease in low-level clouds, contributed significantly to the exceptionally warm temperatures of 2023 and 2024, exceeding many climate model predictions and potentially indicating a higher climate sensitivity than pr...
Progress
24% Bias Score
Glioblastoma Death Highlights Projected 75% Increase in Cases by 2050
Fox News commentator Dr. Kelly Powers, 45, died from glioblastoma, a brain cancer projected to increase by 75 percent by 2050 due to pollution and chemical exposure; despite treatments, she passed away last week leaving behind a young son.
Glioblastoma Death Highlights Projected 75% Increase in Cases by 2050
Fox News commentator Dr. Kelly Powers, 45, died from glioblastoma, a brain cancer projected to increase by 75 percent by 2050 due to pollution and chemical exposure; despite treatments, she passed away last week leaving behind a young son.
Progress
40% Bias Score
Cyborg Beetles for Disaster Relief
Australian researchers are developing cyborg beetles and cockroaches for search and rescue missions by attaching tiny circuit boards that allow remote control of the insects' movements via electrical pulses to their antennae.
Cyborg Beetles for Disaster Relief
Australian researchers are developing cyborg beetles and cockroaches for search and rescue missions by attaching tiny circuit boards that allow remote control of the insects' movements via electrical pulses to their antennae.
Progress
40% Bias Score
Gene Therapy Shows Promise in Treating Fanconi Anemia
A Spanish-led team successfully used gene therapy to treat Fanconi anemia in nine children, achieving significant improvements and offering a safer alternative to bone marrow transplants.
Gene Therapy Shows Promise in Treating Fanconi Anemia
A Spanish-led team successfully used gene therapy to treat Fanconi anemia in nine children, achieving significant improvements and offering a safer alternative to bone marrow transplants.
Progress
16% Bias Score
Missing Protein Segment Linked to 80% of Autism Cases
A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.
Missing Protein Segment Linked to 80% of Autism Cases
A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.
Progress
32% Bias Score
Trump Nominates Space Tourist Isaacman to Lead NASA
Donald Trump nominated Jared Isaacman, a 41-year-old billionaire and experienced private space tourist, to lead NASA, aiming to revitalize the agency and accelerate the Artemis lunar program amid challenges posed by China's ambitious space goals and internal issues within NASA.
Trump Nominates Space Tourist Isaacman to Lead NASA
Donald Trump nominated Jared Isaacman, a 41-year-old billionaire and experienced private space tourist, to lead NASA, aiming to revitalize the agency and accelerate the Artemis lunar program amid challenges posed by China's ambitious space goals and internal issues within NASA.
Progress
64% Bias Score
""Unprecedented Global Warming in 2023 Linked to Reduced Cloud Cover""
""In 2023, global temperatures reached record highs, exceeding predictions by 0.36 degrees Fahrenheit due to decreased cloud cover and increased solar radiation. This suggests a higher climate sensitivity and increased urgency in emission reduction efforts.""
""Unprecedented Global Warming in 2023 Linked to Reduced Cloud Cover""
""In 2023, global temperatures reached record highs, exceeding predictions by 0.36 degrees Fahrenheit due to decreased cloud cover and increased solar radiation. This suggests a higher climate sensitivity and increased urgency in emission reduction efforts.""
Progress
20% Bias Score
Cyborg Beetles for Disaster Relief
Australian researchers are developing cyborg beetles controlled by electrical pulses sent to their antennae, aiming to use them in search and rescue operations after urban disasters, raising ethical considerations.
Cyborg Beetles for Disaster Relief
Australian researchers are developing cyborg beetles controlled by electrical pulses sent to their antennae, aiming to use them in search and rescue operations after urban disasters, raising ethical considerations.
Progress
36% Bias Score
Vaping Impairs Blood Vessel Function, Study Shows
A study shows vaping, with or without nicotine, immediately reduces blood flow velocity and oxygen saturation in vapers, raising concerns about cardiovascular health.
Vaping Impairs Blood Vessel Function, Study Shows
A study shows vaping, with or without nicotine, immediately reduces blood flow velocity and oxygen saturation in vapers, raising concerns about cardiovascular health.
Progress
40% Bias Score
Antibiotic Resistance: Latin American Scientists Offer Hope Amidst Global Crisis
Antibiotic resistance caused 1.27 million deaths in 2019, prompting research into new treatments like novel synthetic antibiotics in Chile and bacteriophage therapies in Uruguay and Colombia, facing challenges in funding and regulation.
Antibiotic Resistance: Latin American Scientists Offer Hope Amidst Global Crisis
Antibiotic resistance caused 1.27 million deaths in 2019, prompting research into new treatments like novel synthetic antibiotics in Chile and bacteriophage therapies in Uruguay and Colombia, facing challenges in funding and regulation.
Progress
24% Bias Score
Fructose Indirectly Fuels Cancer Growth via Liver Lipid Production
A study published in Nature reveals that while cancer cells don't directly use fructose, it fuels tumor growth by causing the liver to produce lipids essential for cancer cell division, creating a potential new therapeutic target.
Fructose Indirectly Fuels Cancer Growth via Liver Lipid Production
A study published in Nature reveals that while cancer cells don't directly use fructose, it fuels tumor growth by causing the liver to produce lipids essential for cancer cell division, creating a potential new therapeutic target.
Progress
32% Bias Score
Global Rise in Childhood Type 1 Diabetes: Finland Shows Highest Rate
Global childhood type 1 diabetes cases increased by 40% since 1990, reaching over 222,000 in 2021; Finland had the highest rate (70/100,000), while mortality fell to 4,280 deaths, highlighting a complex interplay of factors including access to healthcare and environmental influences.
Global Rise in Childhood Type 1 Diabetes: Finland Shows Highest Rate
Global childhood type 1 diabetes cases increased by 40% since 1990, reaching over 222,000 in 2021; Finland had the highest rate (70/100,000), while mortality fell to 4,280 deaths, highlighting a complex interplay of factors including access to healthcare and environmental influences.
Progress
20% Bias Score