Tag #Science

Showing 6,301 to 6,312 of 6,579 results

foxnews.com

🌐 90% Global Worthiness

Dec 5, 13:08

Deep Brain Stimulation Enables Paralyzed Patients to Walk

Two paralyzed patients regained significant mobility, including walking and stair climbing, after deep brain stimulation (DBS) therapy targeting the lateral hypothalamus, a brain region not previously linked to leg control in humans; the study, published in Nature Medicine, suggests a potential brea...

Deep Brain Stimulation Enables Paralyzed Patients to Walk

Two paralyzed patients regained significant mobility, including walking and stair climbing, after deep brain stimulation (DBS) therapy targeting the lateral hypothalamus, a brain region not previously linked to leg control in humans; the study, published in Nature Medicine, suggests a potential brea...

Progress

52% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

What are the long-term implications of this discovery for the treatment of spinal cord injuries?

The study, conducted at EPFL and Lausanne University Hospital, involved implanting electrodes in the lateral hypothalamus and applying DBS. One patient reported feeling their legs and the urge to walk immediately after stimulation. Long-term improvements were observed even without stimulation, suggesting nerve fiber reorganization.

zeit.de

🌐 90% Global Worthiness

Dec 5, 22:09

Record-Low Planetary Albedo Contributed to Unprecedented 2023-2024 Global Warming

A new study reveals that a record-low planetary albedo in 2023, primarily due to a decrease in low-level clouds, contributed significantly to the exceptionally warm temperatures of 2023 and 2024, exceeding many climate model predictions and potentially indicating a higher climate sensitivity than pr...

Record-Low Planetary Albedo Contributed to Unprecedented 2023-2024 Global Warming

A new study reveals that a record-low planetary albedo in 2023, primarily due to a decrease in low-level clouds, contributed significantly to the exceptionally warm temperatures of 2023 and 2024, exceeding many climate model predictions and potentially indicating a higher climate sensitivity than pr...

Progress

24% Bias Score

ShareSaveArticle

Climate Action

12345678

Previous 1 of 8 Next

How does the reduction in low-level clouds contribute to the observed increase in global temperatures?

"The decrease in low-level clouds in recent years, as evidenced by satellite data, is partially responsible for the record-high temperatures in 2023 and 2024. This reduction in cloud cover decreases the Earth's albedo (reflectivity), causing more solar radiation to be absorbed and resulting in a warming effect. This is consistent with climate models suggesting a stronger positive feedback loop between warming and reduced cloud cover."

dailymail.co.uk

🌐 85% Global Worthiness

Dec 5, 01:11

Glioblastoma Death Highlights Projected 75% Increase in Cases by 2050

Fox News commentator Dr. Kelly Powers, 45, died from glioblastoma, a brain cancer projected to increase by 75 percent by 2050 due to pollution and chemical exposure; despite treatments, she passed away last week leaving behind a young son.

Glioblastoma Death Highlights Projected 75% Increase in Cases by 2050

Fox News commentator Dr. Kelly Powers, 45, died from glioblastoma, a brain cancer projected to increase by 75 percent by 2050 due to pollution and chemical exposure; despite treatments, she passed away last week leaving behind a young son.

Progress

40% Bias Score

ShareSaveArticle

12345678

Previous 1 of 8 Next

What are the key factors contributing to the projected 75 percent increase in glioblastoma diagnoses by 2050?

Fox News commentator Dr. Kelly Powers died from glioblastoma, a deadly brain cancer with a less than one-year survival rate. Diagnosed in 2020, she experienced remission but the cancer aggressively returned. Despite multiple surgeries and treatments, she passed away last week at 45, leaving behind a young son.

edition.cnn.com

🌐 85% Global Worthiness

Dec 5, 07:07

Cyborg Beetles for Disaster Relief

Australian researchers are developing cyborg beetles and cockroaches for search and rescue missions by attaching tiny circuit boards that allow remote control of the insects' movements via electrical pulses to their antennae.

Cyborg Beetles for Disaster Relief

Australian researchers are developing cyborg beetles and cockroaches for search and rescue missions by attaching tiny circuit boards that allow remote control of the insects' movements via electrical pulses to their antennae.

Progress

40% Bias Score

ShareSaveArticle

12345678

Previous 1 of 8 Next

How can biohybrid insect robots improve search and rescue operations in disaster zones?

University of Queensland student Lachlan Fitzgerald created a biohybrid robot by attaching a circuit board to a beetle, enabling remote control of its movements via electrical pulses to its antennae. This technology aims to create insect-machine search and rescue teams for disaster zones inaccessible to humans.

elpais.com

🌐 85% Global Worthiness

Dec 5, 10:08

Gene Therapy Shows Promise in Treating Fanconi Anemia

A Spanish-led team successfully used gene therapy to treat Fanconi anemia in nine children, achieving significant improvements and offering a safer alternative to bone marrow transplants.

Gene Therapy Shows Promise in Treating Fanconi Anemia

A Spanish-led team successfully used gene therapy to treat Fanconi anemia in nine children, achieving significant improvements and offering a safer alternative to bone marrow transplants.

Progress

16% Bias Score

ShareSaveArticle

12345678

Previous 1 of 8 Next

How effective is the novel gene therapy in treating Fanconi anemia, and what are its immediate impacts on patients?

A groundbreaking gene therapy successfully treats Fanconi anemia, a rare inherited disease affecting DNA repair. Nine children (ages 3-7) received modified cells, showing significant improvement after seven years, with two achieving over 90% replacement of damaged cells. This success contrasts with previous failures by four leading US teams.

elpais.com

🌐 85% Global Worthiness

Dec 5, 10:08

Missing Protein Segment Linked to 80% of Autism Cases

A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.

Missing Protein Segment Linked to 80% of Autism Cases

A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.

Progress

32% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

What specific genetic mechanism is responsible for a significant portion of autism cases, and how might this discovery lead to new treatments?

Scientists have discovered that a missing segment of the CPEB4 protein, crucial for brain development, is linked to autism in 80% of cases. This 24-letter DNA sequence (GCAAGGACATATGGGCGAAGGAGA) codes for eight amino acids; their absence causes protein aggregation, disrupting 200 autism-related genes.

faz.net

🌐 90% Global Worthiness

Dec 5, 16:09

2024 Global Temperature Exceeds 1.5-Degree Limit, Accelerated Warming Linked to Albedo Reduction

Despite La Niña's cooling effect, 2024's global temperature reached approximately 1.6 degrees Celsius above pre-industrial levels, exceeding the Paris Agreement's 1.5-degree limit due to factors including a reduction in planetary albedo from decreased low-hanging clouds, potentially linked to air po...

2024 Global Temperature Exceeds 1.5-Degree Limit, Accelerated Warming Linked to Albedo Reduction

Despite La Niña's cooling effect, 2024's global temperature reached approximately 1.6 degrees Celsius above pre-industrial levels, exceeding the Paris Agreement's 1.5-degree limit due to factors including a reduction in planetary albedo from decreased low-hanging clouds, potentially linked to air po...

Progress

36% Bias Score

ShareSaveArticle

Climate Action

12345678

Previous 1 of 8 Next

How does the decrease in planetary albedo, particularly the reduction in low-hanging clouds, contribute to the accelerated warming trend observed since 2015?

The accelerated warming trend since 2015, exceeding rates observed in previous decades, cannot be fully explained by greenhouse gas emissions alone. Additional factors, such as the decrease in planetary albedo due to reduced reflectivity from disappearing low-hanging clouds, contribute significantly to this accelerated warming.

nbcnews.com

🌐 90% Global Worthiness

Dec 5, 22:09

""Unprecedented Global Warming in 2023 Linked to Reduced Cloud Cover""

""In 2023, global temperatures reached record highs, exceeding predictions by 0.36 degrees Fahrenheit due to decreased cloud cover and increased solar radiation. This suggests a higher climate sensitivity and increased urgency in emission reduction efforts.""

""Unprecedented Global Warming in 2023 Linked to Reduced Cloud Cover""

""In 2023, global temperatures reached record highs, exceeding predictions by 0.36 degrees Fahrenheit due to decreased cloud cover and increased solar radiation. This suggests a higher climate sensitivity and increased urgency in emission reduction efforts.""

Progress

20% Bias Score

ShareSaveArticle

Climate Action

12345678

Previous 1 of 8 Next

"What is the primary cause of the unexpectedly high global temperatures in 2023?"

""Global temperatures in 2023 were 2.12 degrees Fahrenheit above 20th-century averages, exceeding scientific expectations by roughly 0.36 degrees Fahrenheit. This anomaly is linked to a decrease in cloud cover, allowing more solar radiation to reach the Earth's surface. ""

us.cnn.com

🌐 85% Global Worthiness

Dec 5, 07:07

Cyborg Beetles for Disaster Relief

Australian researchers are developing cyborg beetles controlled by electrical pulses sent to their antennae, aiming to use them in search and rescue operations after urban disasters, raising ethical considerations.

Cyborg Beetles for Disaster Relief

Australian researchers are developing cyborg beetles controlled by electrical pulses sent to their antennae, aiming to use them in search and rescue operations after urban disasters, raising ethical considerations.

Progress

36% Bias Score

ShareSaveArticle

12345678

Previous 1 of 8 Next

What are the immediate applications of cyborg beetles in disaster response?

University of Queensland researchers are developing cyborg beetles for search and rescue operations. A tiny circuit board attached to the beetle's back sends electrical pulses to its antennae, enabling remote control of its movement. This technology could significantly improve disaster response by allowing access to hazardous areas inaccessible to humans.

arabic.cnn.com

🌐 85% Global Worthiness

Dec 5, 10:08

Vaping Impairs Blood Vessel Function, Study Shows

A study shows vaping, with or without nicotine, immediately reduces blood flow velocity and oxygen saturation in vapers, raising concerns about cardiovascular health.

Vaping Impairs Blood Vessel Function, Study Shows

A study shows vaping, with or without nicotine, immediately reduces blood flow velocity and oxygen saturation in vapers, raising concerns about cardiovascular health.

Progress

40% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

How does vaping, with and without nicotine, immediately affect blood vessel function and oxygen saturation?

A new study reveals that vaping, even without nicotine, immediately impacts blood vessel function. Researchers found reduced blood flow and oxygen saturation in vapers compared to non-vapers, indicating potential cardiovascular risks.

elpais.com

🌐 85% Global Worthiness

Dec 5, 10:08

Antibiotic Resistance: Latin American Scientists Offer Hope Amidst Global Crisis

Antibiotic resistance caused 1.27 million deaths in 2019, prompting research into new treatments like novel synthetic antibiotics in Chile and bacteriophage therapies in Uruguay and Colombia, facing challenges in funding and regulation.

Antibiotic Resistance: Latin American Scientists Offer Hope Amidst Global Crisis

Antibiotic resistance caused 1.27 million deaths in 2019, prompting research into new treatments like novel synthetic antibiotics in Chile and bacteriophage therapies in Uruguay and Colombia, facing challenges in funding and regulation.

Progress

24% Bias Score

ShareSaveArticle

12345678

Previous 1 of 8 Next

What is the global health impact of antibiotic resistance, and what immediate actions are needed to address it?

The World Health Organization (WHO) reports 1.27 million deaths from antibiotic resistance in 2019, with an estimated 8.22 million by 2050. This necessitates urgent development of new antibiotics, as existing treatments are losing effectiveness due to overuse and misuse. Only two truly innovative new antibiotics have been approved since 2017.

repubblica.it

🌐 85% Global Worthiness

Dec 5, 13:08

Fructose Indirectly Fuels Cancer Growth via Liver Lipid Production

A study published in Nature reveals that while cancer cells don't directly use fructose, it fuels tumor growth by causing the liver to produce lipids essential for cancer cell division, creating a potential new therapeutic target.

Fructose Indirectly Fuels Cancer Growth via Liver Lipid Production

A study published in Nature reveals that while cancer cells don't directly use fructose, it fuels tumor growth by causing the liver to produce lipids essential for cancer cell division, creating a potential new therapeutic target.

Progress

32% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

How does fructose consumption contribute to tumor growth, given that cancer cells do not directly metabolize it?

A new study reveals that while cancer cells don't directly metabolize fructose, fructose consumption increases tumor growth by altering liver lipid production, which fuels cancer cell division. This finding contrasts with the direct glucose utilization by cancer cells. The study highlights a previously unknown mechanism.

Showing 6,301 to 6,312 of 6,579 results