Tag #Autism

Showing 169 to 177 of 177 results

bbc.com

🌐 85% Global Worthiness

Dec 10, 04:08

Mental Health Suite deemed "wholly inappropriate", leads to death of autistic man

Declan Morrison, 26, died after suffering a catastrophic brain injury from repeatedly hitting his head in a UK mental health suite deemed "wholly inappropriate" for his needs, highlighting systemic failures in care for people with learning disabilities and autism.

Mental Health Suite deemed "wholly inappropriate", leads to death of autistic man

Declan Morrison, 26, died after suffering a catastrophic brain injury from repeatedly hitting his head in a UK mental health suite deemed "wholly inappropriate" for his needs, highlighting systemic failures in care for people with learning disabilities and autism.

Progress

56% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

What immediate changes are needed in the UK's mental health system to prevent deaths like Declan Morrison's?

Declan Morrison, a 26-year-old autistic man with learning disabilities and ADHD, died after repeatedly banging his head against a wall in a mental health suite. His death highlights a critical lack of appropriate care for individuals with complex needs, exposing systemic failures in the UK's mental health system. The coroner deemed the suite "wholly inappropriate" for Declan's needs, citing insufficient staff training and a reliance on CCTV over direct interaction.

theguardian.com

🌐 85% Global Worthiness

Dec 9, 19:09

Trump Nominee to Investigate Vaccine-Autism Link Despite Scientific Consensus

President-elect Trump's nominee for health secretary, Robert F Kennedy Jr, may investigate a link between vaccines and autism, despite scientific consensus rejecting this. The increase in autism diagnoses from one in 150 in 2000 to one in 36 in 2020 (CDC) is cited as justification, contradicting the...

Trump Nominee to Investigate Vaccine-Autism Link Despite Scientific Consensus

President-elect Trump's nominee for health secretary, Robert F Kennedy Jr, may investigate a link between vaccines and autism, despite scientific consensus rejecting this. The increase in autism diagnoses from one in 150 in 2000 to one in 36 in 2020 (CDC) is cited as justification, contradicting the...

Progress

52% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

What are the long-term implications of this decision for vaccine confidence, disease prevention, and the allocation of research funding towards autism?

This decision could undermine public trust in vaccines and potentially lead to decreased vaccination rates, increasing the risk of preventable diseases. The investigation may also divert resources from research into the actual causes of autism, hindering progress towards effective prevention and treatment strategies. The long-term impact could include a resurgence of vaccine-preventable diseases and increased health disparities.

elpais.com

🌐 85% Global Worthiness

Dec 5, 10:08

Missing Protein Segment Linked to 80% of Autism Cases

A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.

Missing Protein Segment Linked to 80% of Autism Cases

A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.

Progress

32% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

What specific genetic mechanism is responsible for a significant portion of autism cases, and how might this discovery lead to new treatments?

Scientists have discovered that a missing segment of the CPEB4 protein, crucial for brain development, is linked to autism in 80% of cases. This 24-letter DNA sequence (GCAAGGACATATGGGCGAAGGAGA) codes for eight amino acids; their absence causes protein aggregation, disrupting 200 autism-related genes.

arabic.euronews.com

🌐 60% Global Worthiness

Nov 18, 01:06

Maternal Infections and Autism Risk

Research explores the link between maternal infections during pregnancy, particularly influenza, and the increased risk of autism in children, focusing on the role of inflammation.

Maternal Infections and Autism Risk

Research explores the link between maternal infections during pregnancy, particularly influenza, and the increased risk of autism in children, focusing on the role of inflammation.

Progress

24% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

What are the potential mechanisms through which maternal infections might contribute to the development of autism?

Research using animal models indicates that maternal immune activation during pregnancy can lead to behavioral changes in offspring resembling aspects of autism. This suggests inflammation, rather than the specific virus, might be crucial.

elmundo.es

🌐 % Global Worthiness

Nov 9, 19:14

Lima Therapeutic Center Child Abuse Scandal

Autistic children were taped to chairs and mouths at a Lima therapeutic center, sparking outrage and an investigation.

Lima Therapeutic Center Child Abuse Scandal

Autistic children were taped to chairs and mouths at a Lima therapeutic center, sparking outrage and an investigation.

Progress

0% Bias Score

ShareSaveArticle

12345678910

Previous 1 of 10 Next

What is CONADIS's role in this case?

CONADIS strongly condemned the violence and is working to ensure legal and social support for the victims and families. They are also collaborating with other agencies to close the center and punish the perpetrators.

bbc.com

🌐 75% Global Worthiness

Dec 10, 19:06

Teenager Guilty of Murdering Girl Who Begged Him to Stop

On September 27, 2023, 17-year-old Hassan Sentamu murdered 15-year-old Elianne Andam in Croydon, south London, after a dispute over belongings with his ex-girlfriend escalated into a fatal stabbing; Sentamu admits manslaughter but denies murder.

Teenager Guilty of Murdering Girl Who Begged Him to Stop

On September 27, 2023, 17-year-old Hassan Sentamu murdered 15-year-old Elianne Andam in Croydon, south London, after a dispute over belongings with his ex-girlfriend escalated into a fatal stabbing; Sentamu admits manslaughter but denies murder.

Progress

48% Bias Score

ShareSaveArticle

Peace, Justice, and Strong Institutions

12345678

Previous 1 of 8 Next

How did the actions of Elianne Andam contribute to the escalation of the conflict?

The incident highlights the tragic consequences of escalating conflicts involving seemingly minor possessions. Sentamu's refusal to return his ex-girlfriend's belongings, coupled with Andam's intervention, triggered a violent outburst. The case underscores the need for conflict resolution strategies and effective anger management.

bbc.com

🌐 75% Global Worthiness

Dec 9, 16:11

15-Year-Old Fatally Stabbed in Croydon Dispute

On September 27, 2023, 15-year-old Elianne Andam was fatally stabbed in Croydon, south London, by 17-year-old Hassan Sentamu during a dispute over a teddy bear between Andam's friend and Sentamu's ex-girlfriend; Sentamu is now on trial for murder.

15-Year-Old Fatally Stabbed in Croydon Dispute

On September 27, 2023, 15-year-old Elianne Andam was fatally stabbed in Croydon, south London, by 17-year-old Hassan Sentamu during a dispute over a teddy bear between Andam's friend and Sentamu's ex-girlfriend; Sentamu is now on trial for murder.

Progress

28% Bias Score

ShareSaveArticle

Peace, Justice, and Strong Institutions

12345678

Previous 1 of 8 Next

What were the immediate consequences of the confrontation between Elianne Andam and Hassan Sentamu?

On September 27, 2023, Elianne Andam, 15, was fatally stabbed in Croydon, south London. The attack occurred outside the Whitgift shopping centre while she intervened in a dispute between her friend and her friend's ex-boyfriend, Hassan Sentamu. Sentamu, then 17, is now on trial for murder.

bbc.com

🌐 65% Global Worthiness

Nov 29, 13:09

Barber's Autism-Sensitive Approach Garners 800,000+ Views

Derbyshire barber Adam Farmer's video showing him cutting the hair of an autistic boy has garnered over 800,000 views. His autism-sensitive approach involves patience, communication, and additional training to ensure a comfortable experience, addressing challenges faced by autistic clients and highl...

Barber's Autism-Sensitive Approach Garners 800,000+ Views

Derbyshire barber Adam Farmer's video showing him cutting the hair of an autistic boy has garnered over 800,000 views. His autism-sensitive approach involves patience, communication, and additional training to ensure a comfortable experience, addressing challenges faced by autistic clients and highl...

Progress

12% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

What is the impact of Adam Farmer's approach to barbering on autistic clients and their families?

A Derbyshire barber, Adam Farmer, has gained online recognition for his approach to cutting the hair of autistic clients. He uses patience and communication to create a comfortable experience, resulting in over 800,000 views of a video showcasing his methods. This highlights a significant need for autism-sensitive services.

pt.euronews.com

🌐 45% Global Worthiness

Nov 17, 22:05

Maternal Infections and Autism Risk

This article discusses the findings of recent studies investigating the link between maternal infections during pregnancy and the increased risk of autism in children, highlighting both human and animal model research.

Maternal Infections and Autism Risk

This article discusses the findings of recent studies investigating the link between maternal infections during pregnancy and the increased risk of autism in children, highlighting both human and animal model research.

Progress

20% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

What is the current scientific understanding of the relationship between maternal infections and the increased risk of autism in children?

Studies suggest a correlation between maternal infections during pregnancy, especially those causing fever, and an increased risk of autism spectrum disorder (ASD) in children. However, a causal link hasn't been definitively established.

Showing 169 to 177 of 177 results