Support Dog Transforms Autistic Girl's Life, Underscoring High Demand and Limited Resources
An 11-year-old autistic girl in Sheffield, Scarlette, has had her life transformed by her support dog, Ivanhoe, who helps her manage anxiety and attend school, highlighting the significant need for more support dogs despite limited resources at Support Dogs UK.
Support Dog Transforms Autistic Girl's Life, Underscoring High Demand and Limited Resources
An 11-year-old autistic girl in Sheffield, Scarlette, has had her life transformed by her support dog, Ivanhoe, who helps her manage anxiety and attend school, highlighting the significant need for more support dogs despite limited resources at Support Dogs UK.
Progress
36% Bias Score
NDIS Funding Cuts Threaten Music Therapy for Autistic Woman
Nineteen-year-old Ava Rinna, diagnosed with level 3 autism, uses music therapy to communicate; however, proposed NDIS funding cuts from $193.99 to $67.56 per hour threaten to end her sessions, impacting her well-being and communication skills.
NDIS Funding Cuts Threaten Music Therapy for Autistic Woman
Nineteen-year-old Ava Rinna, diagnosed with level 3 autism, uses music therapy to communicate; however, proposed NDIS funding cuts from $193.99 to $67.56 per hour threaten to end her sessions, impacting her well-being and communication skills.
Progress
60% Bias Score
Michigan Man Sentenced to 30-100 Years for Brother's Death
A Michigan man, Paul Byron Ferguson, was sentenced to 30-100 years for the July 2022 death of his 15-year-old autistic brother, Timothy, who weighed 69 pounds at death due to abuse involving force-feeding hot sauce, sleep deprivation, and ice baths; their mother, Shanda Vander Ark, received a life s...
Michigan Man Sentenced to 30-100 Years for Brother's Death
A Michigan man, Paul Byron Ferguson, was sentenced to 30-100 years for the July 2022 death of his 15-year-old autistic brother, Timothy, who weighed 69 pounds at death due to abuse involving force-feeding hot sauce, sleep deprivation, and ice baths; their mother, Shanda Vander Ark, received a life s...
Progress
60% Bias Score
Call for Autism Screening in Premature Infants
Rosea Poynter is calling for national screening for autism and ADHD in premature babies after her son, Freddie, born prematurely in 2016, faced a five-year wait for diagnosis, highlighting the need for more robust implementation of existing NICE guidelines and addressing the 140% increase in autism ...
Call for Autism Screening in Premature Infants
Rosea Poynter is calling for national screening for autism and ADHD in premature babies after her son, Freddie, born prematurely in 2016, faced a five-year wait for diagnosis, highlighting the need for more robust implementation of existing NICE guidelines and addressing the 140% increase in autism ...
Progress
44% Bias Score
Teenager Guilty of Murdering Girl Who Begged Him to Stop
On September 27, 2023, 17-year-old Hassan Sentamu murdered 15-year-old Elianne Andam in Croydon, south London, after a dispute over belongings with his ex-girlfriend escalated into a fatal stabbing; Sentamu admits manslaughter but denies murder.
Teenager Guilty of Murdering Girl Who Begged Him to Stop
On September 27, 2023, 17-year-old Hassan Sentamu murdered 15-year-old Elianne Andam in Croydon, south London, after a dispute over belongings with his ex-girlfriend escalated into a fatal stabbing; Sentamu admits manslaughter but denies murder.
Progress
48% Bias Score
15-Year-Old Fatally Stabbed in Croydon Dispute
On September 27, 2023, 15-year-old Elianne Andam was fatally stabbed in Croydon, south London, by 17-year-old Hassan Sentamu during a dispute over a teddy bear between Andam's friend and Sentamu's ex-girlfriend; Sentamu is now on trial for murder.
15-Year-Old Fatally Stabbed in Croydon Dispute
On September 27, 2023, 15-year-old Elianne Andam was fatally stabbed in Croydon, south London, by 17-year-old Hassan Sentamu during a dispute over a teddy bear between Andam's friend and Sentamu's ex-girlfriend; Sentamu is now on trial for murder.
Progress
28% Bias Score
Neurodiversity in Entertainment: Challenging Stereotypes Through Games and Musicals
A new video game and musical are challenging negative stereotypes around neurodiversity, with a reality star's open discussion of his ADHD diagnosis and a 787% increase in UK diagnoses from 1998 to 2018 highlighting the need for more inclusive representation.
Neurodiversity in Entertainment: Challenging Stereotypes Through Games and Musicals
A new video game and musical are challenging negative stereotypes around neurodiversity, with a reality star's open discussion of his ADHD diagnosis and a 787% increase in UK diagnoses from 1998 to 2018 highlighting the need for more inclusive representation.
Progress
36% Bias Score
Michigan Man Sentenced for Brother's Torture Death
In Michigan, Paul Ferguson, 22, and his mother, Shanda Vander Ark, tortured and starved Ferguson's 15-year-old autistic brother, Timothy, to death; Paul received a 30- to 100-year prison sentence, while his mother was given a life sentence without parole.
Michigan Man Sentenced for Brother's Torture Death
In Michigan, Paul Ferguson, 22, and his mother, Shanda Vander Ark, tortured and starved Ferguson's 15-year-old autistic brother, Timothy, to death; Paul received a 30- to 100-year prison sentence, while his mother was given a life sentence without parole.
Progress
56% Bias Score
Trump Open to Vaccine-Autism Link Despite Rising Autism Rates
President-elect Trump's openness to the debunked link between vaccines and autism, despite warnings from Senate Majority Leader Mitch McConnell, comes as autism diagnoses among U.S. 8-year-olds rise to 1 in 36, largely due to improved diagnosis and awareness, not vaccines.
Trump Open to Vaccine-Autism Link Despite Rising Autism Rates
President-elect Trump's openness to the debunked link between vaccines and autism, despite warnings from Senate Majority Leader Mitch McConnell, comes as autism diagnoses among U.S. 8-year-olds rise to 1 in 36, largely due to improved diagnosis and awareness, not vaccines.
Progress
12% Bias Score
Mental Health Suite deemed "wholly inappropriate", leads to death of autistic man
Declan Morrison, 26, died after suffering a catastrophic brain injury from repeatedly hitting his head in a UK mental health suite deemed "wholly inappropriate" for his needs, highlighting systemic failures in care for people with learning disabilities and autism.
Mental Health Suite deemed "wholly inappropriate", leads to death of autistic man
Declan Morrison, 26, died after suffering a catastrophic brain injury from repeatedly hitting his head in a UK mental health suite deemed "wholly inappropriate" for his needs, highlighting systemic failures in care for people with learning disabilities and autism.
Progress
56% Bias Score
Trump Nominee to Investigate Vaccine-Autism Link Despite Scientific Consensus
President-elect Trump's nominee for health secretary, Robert F Kennedy Jr, may investigate a link between vaccines and autism, despite scientific consensus rejecting this. The increase in autism diagnoses from one in 150 in 2000 to one in 36 in 2020 (CDC) is cited as justification, contradicting the...
Trump Nominee to Investigate Vaccine-Autism Link Despite Scientific Consensus
President-elect Trump's nominee for health secretary, Robert F Kennedy Jr, may investigate a link between vaccines and autism, despite scientific consensus rejecting this. The increase in autism diagnoses from one in 150 in 2000 to one in 36 in 2020 (CDC) is cited as justification, contradicting the...
Progress
52% Bias Score
Missing Protein Segment Linked to 80% of Autism Cases
A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.
Missing Protein Segment Linked to 80% of Autism Cases
A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.
Progress
32% Bias Score