Tag #Autism

bbc.com
🌐 85% Global Worthiness
News related image

Support Dog Transforms Autistic Girl's Life, Underscoring High Demand and Limited Resources

An 11-year-old autistic girl in Sheffield, Scarlette, has had her life transformed by her support dog, Ivanhoe, who helps her manage anxiety and attend school, highlighting the significant need for more support dogs despite limited resources at Support Dogs UK.

Progress

36% Bias Score

Good Health and Well-being
theguardian.com
🌐 75% Global Worthiness
News related image

NDIS Funding Cuts Threaten Music Therapy for Autistic Woman

Nineteen-year-old Ava Rinna, diagnosed with level 3 autism, uses music therapy to communicate; however, proposed NDIS funding cuts from $193.99 to $67.56 per hour threaten to end her sessions, impacting her well-being and communication skills.

Progress

60% Bias Score

Good Health and Well-being
dailymail.co.uk
🌐 85% Global Worthiness
News related image

Michigan Man Sentenced to 30-100 Years for Brother's Death

A Michigan man, Paul Byron Ferguson, was sentenced to 30-100 years for the July 2022 death of his 15-year-old autistic brother, Timothy, who weighed 69 pounds at death due to abuse involving force-feeding hot sauce, sleep deprivation, and ice baths; their mother, Shanda Vander Ark, received a life s...

Progress

60% Bias Score

No Poverty
bbc.com
🌐 75% Global Worthiness
News related image

Call for Autism Screening in Premature Infants

Rosea Poynter is calling for national screening for autism and ADHD in premature babies after her son, Freddie, born prematurely in 2016, faced a five-year wait for diagnosis, highlighting the need for more robust implementation of existing NICE guidelines and addressing the 140% increase in autism ...

Progress

44% Bias Score

Quality Education
bbc.com
🌐 75% Global Worthiness
News related image

Teenager Guilty of Murdering Girl Who Begged Him to Stop

On September 27, 2023, 17-year-old Hassan Sentamu murdered 15-year-old Elianne Andam in Croydon, south London, after a dispute over belongings with his ex-girlfriend escalated into a fatal stabbing; Sentamu admits manslaughter but denies murder.

Progress

48% Bias Score

Peace, Justice, and Strong Institutions
bbc.com
🌐 75% Global Worthiness
News related image

15-Year-Old Fatally Stabbed in Croydon Dispute

On September 27, 2023, 15-year-old Elianne Andam was fatally stabbed in Croydon, south London, by 17-year-old Hassan Sentamu during a dispute over a teddy bear between Andam's friend and Sentamu's ex-girlfriend; Sentamu is now on trial for murder.

Progress

28% Bias Score

Peace, Justice, and Strong Institutions
news.sky.com
🌐 75% Global Worthiness
News related image

Neurodiversity in Entertainment: Challenging Stereotypes Through Games and Musicals

A new video game and musical are challenging negative stereotypes around neurodiversity, with a reality star's open discussion of his ADHD diagnosis and a 787% increase in UK diagnoses from 1998 to 2018 highlighting the need for more inclusive representation.

Progress

36% Bias Score

Reduced Inequality
dailymail.co.uk
🌐 85% Global Worthiness
News related image

Michigan Man Sentenced for Brother's Torture Death

In Michigan, Paul Ferguson, 22, and his mother, Shanda Vander Ark, tortured and starved Ferguson's 15-year-old autistic brother, Timothy, to death; Paul received a 30- to 100-year prison sentence, while his mother was given a life sentence without parole.

Progress

56% Bias Score

No Poverty
apnews.com
🌐 85% Global Worthiness
News related image

Trump Open to Vaccine-Autism Link Despite Rising Autism Rates

President-elect Trump's openness to the debunked link between vaccines and autism, despite warnings from Senate Majority Leader Mitch McConnell, comes as autism diagnoses among U.S. 8-year-olds rise to 1 in 36, largely due to improved diagnosis and awareness, not vaccines.

Progress

12% Bias Score

Good Health and Well-being
bbc.com
🌐 85% Global Worthiness
News related image

Mental Health Suite deemed "wholly inappropriate", leads to death of autistic man

Declan Morrison, 26, died after suffering a catastrophic brain injury from repeatedly hitting his head in a UK mental health suite deemed "wholly inappropriate" for his needs, highlighting systemic failures in care for people with learning disabilities and autism.

Progress

56% Bias Score

Good Health and Well-being
theguardian.com
🌐 85% Global Worthiness
News related image

Trump Nominee to Investigate Vaccine-Autism Link Despite Scientific Consensus

President-elect Trump's nominee for health secretary, Robert F Kennedy Jr, may investigate a link between vaccines and autism, despite scientific consensus rejecting this. The increase in autism diagnoses from one in 150 in 2000 to one in 36 in 2020 (CDC) is cited as justification, contradicting the...

Progress

52% Bias Score

Good Health and Well-being
elpais.com
🌐 85% Global Worthiness
News related image

Missing Protein Segment Linked to 80% of Autism Cases

A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.

Progress

32% Bias Score

Good Health and Well-being