Tag #Research

Showing 97 to 108 of 188 results

forbes.com
🌐 65% Global Worthiness
News related image

Google Scholar: Enhancing Workplace Communication and Culture

Google Scholar, a free search engine for scholarly articles, enhances workplace communication by providing credible research, fostering informed discussions, and promoting evidence-based decision-making, ultimately strengthening workplace culture and innovation.

Progress

44% Bias Score

Quality Education
forbes.com
🌐 85% Global Worthiness
News related image

India's IPO Boom: Can Higher Education Keep Pace?

India's IPO market has overtaken China's, but concerns exist about whether its higher education system can provide the necessary skilled workforce; challenges include uneven quality, faculty shortages, and limited research output.

Progress

24% Bias Score

Quality Education
bbc.com
🌐 85% Global Worthiness
News related image

Long COVID: Blood Biomarkers, Paxlovid Trials, and Repeated Infection Risks

Research worldwide reveals potential biomarkers for long COVID, including unusual T-cell activity and elevated interferon-gamma, with studies exploring the antiviral drug Paxlovid's impact and the link between repeated COVID infections and long COVID risk.

Progress

24% Bias Score

Good Health and Well-being
zeit.de
🌐 75% Global Worthiness
News related image

Berlin Universities Protest 250 Million Euro Budget Cut

Berlin's universities, unions, and research organizations are protesting a 250 million Euro budget cut by the Senate, planned for 2025, with a demonstration today near the Berlin House of Representatives, where the supplementary budget will be decided. The demonstration, which includes approximately...

Progress

44% Bias Score

Quality Education
kathimerini.gr
🌐 75% Global Worthiness
News related image

Greek Universities Secure €62 Million for Joint Master's Programs with International Institutions

Four Greek universities—Democritus University of Thrace, University of the Aegean, University of Western Macedonia, and Hellenic Mediterranean University—submitted 28 proposals for joint master's programs with 42 prestigious international universities, securing €62 million in funding from the Recove...

Progress

40% Bias Score

Quality Education
fr.allafrica.com
🌐 65% Global Worthiness
News related image

Moroccan Professor Awarded for Economic Intelligence Leadership

Professor Driss Guerraoui, president of the Université Ouverte de Dakhla, received the 2024 SCIP International Leadership Award in Economic Intelligence in Barcelona on December 4th, recognizing his contributions to economic intelligence research, education, and advocacy in Morocco and Africa since ...

Progress

36% Bias Score

Quality Education
taz.de
🌐 85% Global Worthiness
News related image

African Expertise Key to Combating Infectious Diseases

Christian Happi, director of the African Centre of Excellence for Genomics of Infectious Diseases (ACEGID), discusses why Africa is the best continent to study infectious diseases, highlighting the successful containment of the 2014 Ebola outbreak in Nigeria as a prime example of the impact of local...

Progress

44% Bias Score

Good Health and Well-being
nos.nl
🌐 85% Global Worthiness
News related image

Funding Cut Jeopardizes Children's Long COVID Care in Netherlands

The Dutch government's rejection of €21 million for researching children's long COVID treatments threatens the 2025 opening of specialized clinics and delays effective care for an estimated 40,000 affected children, with thousands already severely impacted.

Progress

52% Bias Score

Good Health and Well-being
forbes.com
🌐 85% Global Worthiness
News related image

AI Generates Academic Papers: Implications for Education

Robert Novy-Marx and Mihail Velikov's study shows AI can produce convincing academic papers on stock market prediction in minutes, raising concerns about academic integrity and prompting educators to rethink teaching methods.

Progress

40% Bias Score

Quality Education
kathimerini.gr
🌐 75% Global Worthiness
News related image

Advancements in Age-Related Macular Degeneration Treatment and Prevention

Age-related macular degeneration (AMD) is a leading cause of vision loss in people over 50; research reveals two types, dry and wet, with varied treatments including antioxidants, anti-VEGF injections, and laser surgery; future therapies are under investigation.

Progress

20% Bias Score

Good Health and Well-being
kathimerini.gr
🌐 85% Global Worthiness
News related image

€4.7M EU Center to Develop Infectious Disease Diagnostics

A new €4.7 million EU-funded center, DxHub, will be created at the Foundation for Research and Technology - Hellas (FORTH) in January 2025 to develop innovative diagnostic tools for infectious diseases, specifically addressing the increasing threat in Southern Europe and the Mediterranean, and colla...

Progress

4% Bias Score

Good Health and Well-being
elpais.com
🌐 85% Global Worthiness
News related image

Missing Protein Segment Linked to 80% of Autism Cases

A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.

Progress

32% Bias Score

Good Health and Well-being

Showing 97 to 108 of 188 results