Showing 97 to 108 of 188 results


Google Scholar: Enhancing Workplace Communication and Culture
Google Scholar, a free search engine for scholarly articles, enhances workplace communication by providing credible research, fostering informed discussions, and promoting evidence-based decision-making, ultimately strengthening workplace culture and innovation.
Google Scholar: Enhancing Workplace Communication and Culture
Google Scholar, a free search engine for scholarly articles, enhances workplace communication by providing credible research, fostering informed discussions, and promoting evidence-based decision-making, ultimately strengthening workplace culture and innovation.
Progress
44% Bias Score


India's IPO Boom: Can Higher Education Keep Pace?
India's IPO market has overtaken China's, but concerns exist about whether its higher education system can provide the necessary skilled workforce; challenges include uneven quality, faculty shortages, and limited research output.
India's IPO Boom: Can Higher Education Keep Pace?
India's IPO market has overtaken China's, but concerns exist about whether its higher education system can provide the necessary skilled workforce; challenges include uneven quality, faculty shortages, and limited research output.
Progress
24% Bias Score


Long COVID: Blood Biomarkers, Paxlovid Trials, and Repeated Infection Risks
Research worldwide reveals potential biomarkers for long COVID, including unusual T-cell activity and elevated interferon-gamma, with studies exploring the antiviral drug Paxlovid's impact and the link between repeated COVID infections and long COVID risk.
Long COVID: Blood Biomarkers, Paxlovid Trials, and Repeated Infection Risks
Research worldwide reveals potential biomarkers for long COVID, including unusual T-cell activity and elevated interferon-gamma, with studies exploring the antiviral drug Paxlovid's impact and the link between repeated COVID infections and long COVID risk.
Progress
24% Bias Score


Berlin Universities Protest 250 Million Euro Budget Cut
Berlin's universities, unions, and research organizations are protesting a 250 million Euro budget cut by the Senate, planned for 2025, with a demonstration today near the Berlin House of Representatives, where the supplementary budget will be decided. The demonstration, which includes approximately...
Berlin Universities Protest 250 Million Euro Budget Cut
Berlin's universities, unions, and research organizations are protesting a 250 million Euro budget cut by the Senate, planned for 2025, with a demonstration today near the Berlin House of Representatives, where the supplementary budget will be decided. The demonstration, which includes approximately...
Progress
44% Bias Score


Greek Universities Secure €62 Million for Joint Master's Programs with International Institutions
Four Greek universities—Democritus University of Thrace, University of the Aegean, University of Western Macedonia, and Hellenic Mediterranean University—submitted 28 proposals for joint master's programs with 42 prestigious international universities, securing €62 million in funding from the Recove...
Greek Universities Secure €62 Million for Joint Master's Programs with International Institutions
Four Greek universities—Democritus University of Thrace, University of the Aegean, University of Western Macedonia, and Hellenic Mediterranean University—submitted 28 proposals for joint master's programs with 42 prestigious international universities, securing €62 million in funding from the Recove...
Progress
40% Bias Score


Moroccan Professor Awarded for Economic Intelligence Leadership
Professor Driss Guerraoui, president of the Université Ouverte de Dakhla, received the 2024 SCIP International Leadership Award in Economic Intelligence in Barcelona on December 4th, recognizing his contributions to economic intelligence research, education, and advocacy in Morocco and Africa since ...
Moroccan Professor Awarded for Economic Intelligence Leadership
Professor Driss Guerraoui, president of the Université Ouverte de Dakhla, received the 2024 SCIP International Leadership Award in Economic Intelligence in Barcelona on December 4th, recognizing his contributions to economic intelligence research, education, and advocacy in Morocco and Africa since ...
Progress
36% Bias Score

African Expertise Key to Combating Infectious Diseases
Christian Happi, director of the African Centre of Excellence for Genomics of Infectious Diseases (ACEGID), discusses why Africa is the best continent to study infectious diseases, highlighting the successful containment of the 2014 Ebola outbreak in Nigeria as a prime example of the impact of local...

African Expertise Key to Combating Infectious Diseases
Christian Happi, director of the African Centre of Excellence for Genomics of Infectious Diseases (ACEGID), discusses why Africa is the best continent to study infectious diseases, highlighting the successful containment of the 2014 Ebola outbreak in Nigeria as a prime example of the impact of local...
Progress
44% Bias Score

Funding Cut Jeopardizes Children's Long COVID Care in Netherlands
The Dutch government's rejection of €21 million for researching children's long COVID treatments threatens the 2025 opening of specialized clinics and delays effective care for an estimated 40,000 affected children, with thousands already severely impacted.

Funding Cut Jeopardizes Children's Long COVID Care in Netherlands
The Dutch government's rejection of €21 million for researching children's long COVID treatments threatens the 2025 opening of specialized clinics and delays effective care for an estimated 40,000 affected children, with thousands already severely impacted.
Progress
52% Bias Score

AI Generates Academic Papers: Implications for Education
Robert Novy-Marx and Mihail Velikov's study shows AI can produce convincing academic papers on stock market prediction in minutes, raising concerns about academic integrity and prompting educators to rethink teaching methods.

AI Generates Academic Papers: Implications for Education
Robert Novy-Marx and Mihail Velikov's study shows AI can produce convincing academic papers on stock market prediction in minutes, raising concerns about academic integrity and prompting educators to rethink teaching methods.
Progress
40% Bias Score

Advancements in Age-Related Macular Degeneration Treatment and Prevention
Age-related macular degeneration (AMD) is a leading cause of vision loss in people over 50; research reveals two types, dry and wet, with varied treatments including antioxidants, anti-VEGF injections, and laser surgery; future therapies are under investigation.

Advancements in Age-Related Macular Degeneration Treatment and Prevention
Age-related macular degeneration (AMD) is a leading cause of vision loss in people over 50; research reveals two types, dry and wet, with varied treatments including antioxidants, anti-VEGF injections, and laser surgery; future therapies are under investigation.
Progress
20% Bias Score

€4.7M EU Center to Develop Infectious Disease Diagnostics
A new €4.7 million EU-funded center, DxHub, will be created at the Foundation for Research and Technology - Hellas (FORTH) in January 2025 to develop innovative diagnostic tools for infectious diseases, specifically addressing the increasing threat in Southern Europe and the Mediterranean, and colla...

€4.7M EU Center to Develop Infectious Disease Diagnostics
A new €4.7 million EU-funded center, DxHub, will be created at the Foundation for Research and Technology - Hellas (FORTH) in January 2025 to develop innovative diagnostic tools for infectious diseases, specifically addressing the increasing threat in Southern Europe and the Mediterranean, and colla...
Progress
4% Bias Score

Missing Protein Segment Linked to 80% of Autism Cases
A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.

Missing Protein Segment Linked to 80% of Autism Cases
A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.
Progress
32% Bias Score
Showing 97 to 108 of 188 results