Tag #Research

Showing 85 to 96 of 172 results

bbc.com

🌐 85% Global Worthiness

Dec 26, 13:07

Long COVID: Blood Biomarkers, Paxlovid Trials, and Repeated Infection Risks

Research worldwide reveals potential biomarkers for long COVID, including unusual T-cell activity and elevated interferon-gamma, with studies exploring the antiviral drug Paxlovid's impact and the link between repeated COVID infections and long COVID risk.

Long COVID: Blood Biomarkers, Paxlovid Trials, and Repeated Infection Risks

Research worldwide reveals potential biomarkers for long COVID, including unusual T-cell activity and elevated interferon-gamma, with studies exploring the antiviral drug Paxlovid's impact and the link between repeated COVID infections and long COVID risk.

Progress

24% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

What biological evidence supports the existence of long COVID, and what are the immediate implications for diagnosis and treatment?

Akiko Iwasaki's research at Yale has identified blood biomarkers that can distinguish between long COVID patients and others with 96% accuracy. This suggests a biological basis for long COVID, although further research is needed to develop simple diagnostic tests. Current research is exploring the antiviral drug Paxlovid's potential to mitigate long COVID symptoms.

zeit.de

🌐 75% Global Worthiness

Dec 19, 04:09

Berlin Universities Protest 250 Million Euro Budget Cut

Berlin's universities, unions, and research organizations are protesting a 250 million Euro budget cut by the Senate, planned for 2025, with a demonstration today near the Berlin House of Representatives, where the supplementary budget will be decided. The demonstration, which includes approximately...

Berlin Universities Protest 250 Million Euro Budget Cut

Berlin's universities, unions, and research organizations are protesting a 250 million Euro budget cut by the Senate, planned for 2025, with a demonstration today near the Berlin House of Representatives, where the supplementary budget will be decided. The demonstration, which includes approximately...

Progress

44% Bias Score

ShareSaveArticle

Quality Education

12345678

Previous 1 of 8 Next

How do the universities' concerns about short-term funding impact their long-term strategic planning and research capacity?

The planned cuts represent a severe setback for Berlin's universities and research institutions, undermining their ability to plan effectively. The short notice and lack of communication from the Senate have been criticized. Concerns are raised about the long-term consequences for research and teaching.

kathimerini.gr

🌐 75% Global Worthiness

Dec 11, 22:09

Greek Universities Secure €62 Million for Joint Master's Programs with International Institutions

Four Greek universities—Democritus University of Thrace, University of the Aegean, University of Western Macedonia, and Hellenic Mediterranean University—submitted 28 proposals for joint master's programs with 42 prestigious international universities, securing €62 million in funding from the Recove...

Greek Universities Secure €62 Million for Joint Master's Programs with International Institutions

Four Greek universities—Democritus University of Thrace, University of the Aegean, University of Western Macedonia, and Hellenic Mediterranean University—submitted 28 proposals for joint master's programs with 42 prestigious international universities, securing €62 million in funding from the Recove...

Progress

40% Bias Score

ShareSaveArticle

Quality Education

12345678

Previous 1 of 8 Next

What are the primary challenges and considerations for implementing these joint master's programs?

This initiative aims to enhance the competitiveness of Greek universities by creating joint master's programs in innovative fields, attracting international students, and reducing brain drain. The programs will be taught in English, primarily online, with faculty from both Greek and foreign institutions.

fr.allafrica.com

🌐 65% Global Worthiness

Dec 6, 22:11

Moroccan Professor Awarded for Economic Intelligence Leadership

Professor Driss Guerraoui, president of the Université Ouverte de Dakhla, received the 2024 SCIP International Leadership Award in Economic Intelligence in Barcelona on December 4th, recognizing his contributions to economic intelligence research, education, and advocacy in Morocco and Africa since ...

Moroccan Professor Awarded for Economic Intelligence Leadership

Professor Driss Guerraoui, president of the Université Ouverte de Dakhla, received the 2024 SCIP International Leadership Award in Economic Intelligence in Barcelona on December 4th, recognizing his contributions to economic intelligence research, education, and advocacy in Morocco and Africa since ...

Progress

36% Bias Score

ShareSaveArticle

Quality Education

12345678

Previous 1 of 8 Next

How have Professor Guerraoui's initiatives shaped the landscape of economic intelligence in Morocco and Africa?

Guerraoui's award reflects the growing importance of economic intelligence globally and particularly in Africa. His work, spanning from the first international meeting on economic intelligence in Tetouan (2003) to the creation of the African Forum of Economic Intelligence Associations (2018), has fostered research, training, and publication in the field, creating a network of collaboration across the continent. The SCIP, a leading global organization, bestowed the award, signifying international recognition of these achievements.

nos.nl

🌐 75% Global Worthiness

Dec 5, 10:08

Dutch Parliament Rejects Funding for Long COVID Research

A proposed €21 million research budget for long COVID symptom treatment in the Netherlands is facing defeat in parliament, delaying large-scale treatment for nearly half a million patients due to budgetary constraints and competing priorities within the government.

Dutch Parliament Rejects Funding for Long COVID Research

A proposed €21 million research budget for long COVID symptom treatment in the Netherlands is facing defeat in parliament, delaying large-scale treatment for nearly half a million patients due to budgetary constraints and competing priorities within the government.

Progress

48% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

What is the immediate impact of insufficient funding for long COVID symptom research in the Netherlands?

Dutch patient advocacy groups warn that a lack of funding for long COVID research may hinder treatment for almost half a million patients. A parliamentary amendment requesting €21 million for additional research lacks majority support, jeopardizing large-scale treatment efforts. While tens of millions are spent on researching long COVID causes, few studies focus on repurposing existing medications to alleviate symptoms, which is currently the most achievable goal.

npr.org

🌐 65% Global Worthiness

Dec 4, 04:09

Muscle Memory: Rapid Regrowth After Strength Training Break

A study published in the Scandinavian Journal of Medicine & Science in Sports revealed that individuals regained muscle strength and size within five weeks after a 10-week break from strength training, highlighting the phenomenon of muscle memory and challenging previous assumptions about detraining...

Muscle Memory: Rapid Regrowth After Strength Training Break

A study published in the Scandinavian Journal of Medicine & Science in Sports revealed that individuals regained muscle strength and size within five weeks after a 10-week break from strength training, highlighting the phenomenon of muscle memory and challenging previous assumptions about detraining...

Progress

36% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

How quickly do people regain muscle strength and size after a significant break from strength training?

Research from the University of Jyvaskyla shows that after a 10-week break from strength training, participants regained previous muscle strength and size within five weeks of retraining. This was true even for those with no prior training experience, highlighting the phenomenon of muscle memory.

forbes.com

🌐 85% Global Worthiness

Dec 20, 13:12

AI Generates Academic Papers: Implications for Education

Robert Novy-Marx and Mihail Velikov's study shows AI can produce convincing academic papers on stock market prediction in minutes, raising concerns about academic integrity and prompting educators to rethink teaching methods.

AI Generates Academic Papers: Implications for Education

Robert Novy-Marx and Mihail Velikov's study shows AI can produce convincing academic papers on stock market prediction in minutes, raising concerns about academic integrity and prompting educators to rethink teaching methods.

Progress

40% Bias Score

ShareSaveArticle

Quality Education

12345678

Previous 1 of 8 Next

How does AI's ability to generate credible academic papers in minutes impact the future of academic research and education?

A recent study by Novy-Marx and Velikov demonstrated that AI can generate high-quality academic papers on stock market prediction in minutes, compared to the months or years it takes human researchers. These AI-generated papers, while sometimes fabricating citations, adhered to rigorous academic standards, highlighting both AI's potential and ethical concerns.

kathimerini.gr

🌐 75% Global Worthiness

Dec 16, 13:10

Advancements in Age-Related Macular Degeneration Treatment and Prevention

Age-related macular degeneration (AMD) is a leading cause of vision loss in people over 50; research reveals two types, dry and wet, with varied treatments including antioxidants, anti-VEGF injections, and laser surgery; future therapies are under investigation.

Advancements in Age-Related Macular Degeneration Treatment and Prevention

Age-related macular degeneration (AMD) is a leading cause of vision loss in people over 50; research reveals two types, dry and wet, with varied treatments including antioxidants, anti-VEGF injections, and laser surgery; future therapies are under investigation.

Progress

20% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

How do the two types of AMD differ in their causes, progression, and available treatments?

Research reveals that AMD involves two types: dry (more common) and wet. Dry AMD involves the accumulation of lipids and proteins, leading to vision loss, while wet AMD features abnormal blood vessel growth, causing rapid vision damage. Treatments vary; dry AMD progression can sometimes be slowed with antioxidants, while wet AMD is addressed with anti-VEGF injections or laser surgery.

kathimerini.gr

🌐 85% Global Worthiness

Dec 10, 16:13

€4.7M EU Center to Develop Infectious Disease Diagnostics

A new €4.7 million EU-funded center, DxHub, will be created at the Foundation for Research and Technology - Hellas (FORTH) in January 2025 to develop innovative diagnostic tools for infectious diseases, specifically addressing the increasing threat in Southern Europe and the Mediterranean, and colla...

€4.7M EU Center to Develop Infectious Disease Diagnostics

A new €4.7 million EU-funded center, DxHub, will be created at the Foundation for Research and Technology - Hellas (FORTH) in January 2025 to develop innovative diagnostic tools for infectious diseases, specifically addressing the increasing threat in Southern Europe and the Mediterranean, and colla...

Progress

4% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

What is the primary goal of the newly established DxHub center, and how will it address the urgent need for improved infectious disease diagnostics in Europe?

"A new €4.7 million EU-funded center, DxHub, will be established at the Foundation for Research and Technology - Hellas (FORTH) in January 2025 to develop innovative diagnostic tools for infectious diseases. This initiative, led by the Institute of Molecular Biology and Biotechnology (IMBB-FORTH) and NOVA University of Lisbon, addresses the increasing threat of infectious diseases in Europe, particularly in Southern Europe and the Mediterranean.

elpais.com

🌐 85% Global Worthiness

Dec 5, 10:08

Missing Protein Segment Linked to 80% of Autism Cases

A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.

Missing Protein Segment Linked to 80% of Autism Cases

A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.

Progress

32% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

What specific genetic mechanism is responsible for a significant portion of autism cases, and how might this discovery lead to new treatments?

Scientists have discovered that a missing segment of the CPEB4 protein, crucial for brain development, is linked to autism in 80% of cases. This 24-letter DNA sequence (GCAAGGACATATGGGCGAAGGAGA) codes for eight amino acids; their absence causes protein aggregation, disrupting 200 autism-related genes.

nos.nl

🌐 75% Global Worthiness

Dec 5, 10:09

Dutch Parliament to Reject €21 Million for Long-COVID Research

The Dutch parliament is set to reject a €21 million amendment for long-COVID research, potentially delaying effective symptom management for almost half a million patients, as the government prioritizes existing research results.

Dutch Parliament to Reject €21 Million for Long-COVID Research

The Dutch parliament is set to reject a €21 million amendment for long-COVID research, potentially delaying effective symptom management for almost half a million patients, as the government prioritizes existing research results.

Progress

48% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

Will the Dutch parliament approve the €21 million amendment for additional long-COVID research, and what are the immediate consequences for patients if it fails?

Dutch patient advocacy groups warn that a lack of funding for long-COVID research may hinder large-scale treatment. A parliamentary vote on a €21 million research budget amendment is expected to fail, delaying effective symptom management for almost half a million patients. While tens of millions are spent on research into long-COVID causes, few studies focus on repurposing existing drugs to alleviate symptoms.

bbc.com

🌐 65% Global Worthiness

Nov 30, 13:07

Face Blindness Project Seeks to Raise Awareness and Develop Support Resources

Affecting 2–3% of the population, prosopagnosia, or face blindness, severely impairs facial recognition, causing social challenges for sufferers like Dr. Hayley Ryder, who cannot recognize her family; a new project aims to raise awareness and develop support resources.

Face Blindness Project Seeks to Raise Awareness and Develop Support Resources

Affecting 2–3% of the population, prosopagnosia, or face blindness, severely impairs facial recognition, causing social challenges for sufferers like Dr. Hayley Ryder, who cannot recognize her family; a new project aims to raise awareness and develop support resources.

Progress

20% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

What is the prevalence and impact of prosopagnosia on personal relationships and social interactions?

Prosopagnosia, or face blindness, impacts an estimated 2-3% of the population, hindering facial recognition. This neurological condition causes difficulties in identifying even close family members, leading to social isolation and misinterpretations of behavior. A new project aims to increase awareness and develop support resources.

Showing 85 to 96 of 172 results