Showing 85 to 96 of 169 results


Advancements in Age-Related Macular Degeneration Treatment and Prevention
Age-related macular degeneration (AMD) is a leading cause of vision loss in people over 50; research reveals two types, dry and wet, with varied treatments including antioxidants, anti-VEGF injections, and laser surgery; future therapies are under investigation.
Advancements in Age-Related Macular Degeneration Treatment and Prevention
Age-related macular degeneration (AMD) is a leading cause of vision loss in people over 50; research reveals two types, dry and wet, with varied treatments including antioxidants, anti-VEGF injections, and laser surgery; future therapies are under investigation.
Progress
20% Bias Score


€4.7M EU Center to Develop Infectious Disease Diagnostics
A new €4.7 million EU-funded center, DxHub, will be created at the Foundation for Research and Technology - Hellas (FORTH) in January 2025 to develop innovative diagnostic tools for infectious diseases, specifically addressing the increasing threat in Southern Europe and the Mediterranean, and colla...
€4.7M EU Center to Develop Infectious Disease Diagnostics
A new €4.7 million EU-funded center, DxHub, will be created at the Foundation for Research and Technology - Hellas (FORTH) in January 2025 to develop innovative diagnostic tools for infectious diseases, specifically addressing the increasing threat in Southern Europe and the Mediterranean, and colla...
Progress
4% Bias Score


Missing Protein Segment Linked to 80% of Autism Cases
A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.
Missing Protein Segment Linked to 80% of Autism Cases
A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.
Progress
32% Bias Score


Dutch Parliament to Reject €21 Million for Long-COVID Research
The Dutch parliament is set to reject a €21 million amendment for long-COVID research, potentially delaying effective symptom management for almost half a million patients, as the government prioritizes existing research results.
Dutch Parliament to Reject €21 Million for Long-COVID Research
The Dutch parliament is set to reject a €21 million amendment for long-COVID research, potentially delaying effective symptom management for almost half a million patients, as the government prioritizes existing research results.
Progress
48% Bias Score


Face Blindness Project Seeks to Raise Awareness and Develop Support Resources
Affecting 2–3% of the population, prosopagnosia, or face blindness, severely impairs facial recognition, causing social challenges for sufferers like Dr. Hayley Ryder, who cannot recognize her family; a new project aims to raise awareness and develop support resources.
Face Blindness Project Seeks to Raise Awareness and Develop Support Resources
Affecting 2–3% of the population, prosopagnosia, or face blindness, severely impairs facial recognition, causing social challenges for sufferers like Dr. Hayley Ryder, who cannot recognize her family; a new project aims to raise awareness and develop support resources.
Progress
20% Bias Score


Foreign Interference in European Universities: MEPs Warn of Espionage and Influence Operations
Members of the European Parliament warn that Chinese, Russian, and Iranian actors are exploiting academic partnerships in European universities for espionage, technology transfer, and influence operations, particularly in strategic research areas.
Foreign Interference in European Universities: MEPs Warn of Espionage and Influence Operations
Members of the European Parliament warn that Chinese, Russian, and Iranian actors are exploiting academic partnerships in European universities for espionage, technology transfer, and influence operations, particularly in strategic research areas.
Progress
40% Bias Score

Greek Universities Secure €62 Million for Joint Master's Programs with International Institutions
Four Greek universities—Democritus University of Thrace, University of the Aegean, University of Western Macedonia, and Hellenic Mediterranean University—submitted 28 proposals for joint master's programs with 42 prestigious international universities, securing €62 million in funding from the Recove...

Greek Universities Secure €62 Million for Joint Master's Programs with International Institutions
Four Greek universities—Democritus University of Thrace, University of the Aegean, University of Western Macedonia, and Hellenic Mediterranean University—submitted 28 proposals for joint master's programs with 42 prestigious international universities, securing €62 million in funding from the Recove...
Progress
40% Bias Score

Moroccan Professor Awarded for Economic Intelligence Leadership
Professor Driss Guerraoui, president of the Université Ouverte de Dakhla, received the 2024 SCIP International Leadership Award in Economic Intelligence in Barcelona on December 4th, recognizing his contributions to economic intelligence research, education, and advocacy in Morocco and Africa since ...

Moroccan Professor Awarded for Economic Intelligence Leadership
Professor Driss Guerraoui, president of the Université Ouverte de Dakhla, received the 2024 SCIP International Leadership Award in Economic Intelligence in Barcelona on December 4th, recognizing his contributions to economic intelligence research, education, and advocacy in Morocco and Africa since ...
Progress
36% Bias Score

Dutch Parliament Rejects Funding for Long COVID Research
A proposed €21 million research budget for long COVID symptom treatment in the Netherlands is facing defeat in parliament, delaying large-scale treatment for nearly half a million patients due to budgetary constraints and competing priorities within the government.

Dutch Parliament Rejects Funding for Long COVID Research
A proposed €21 million research budget for long COVID symptom treatment in the Netherlands is facing defeat in parliament, delaying large-scale treatment for nearly half a million patients due to budgetary constraints and competing priorities within the government.
Progress
48% Bias Score

Muscle Memory: Rapid Regrowth After Strength Training Break
A study published in the Scandinavian Journal of Medicine & Science in Sports revealed that individuals regained muscle strength and size within five weeks after a 10-week break from strength training, highlighting the phenomenon of muscle memory and challenging previous assumptions about detraining...

Muscle Memory: Rapid Regrowth After Strength Training Break
A study published in the Scandinavian Journal of Medicine & Science in Sports revealed that individuals regained muscle strength and size within five weeks after a 10-week break from strength training, highlighting the phenomenon of muscle memory and challenging previous assumptions about detraining...
Progress
36% Bias Score

Foreign Interference Targeting European Universities
European universities are increasingly targeted by foreign powers like China and Russia, which exploit academic partnerships for technology theft, espionage, and influence operations; this has prompted calls for improved transparency, funding, and intelligence coordination.

Foreign Interference Targeting European Universities
European universities are increasingly targeted by foreign powers like China and Russia, which exploit academic partnerships for technology theft, espionage, and influence operations; this has prompted calls for improved transparency, funding, and intelligence coordination.
Progress
40% Bias Score

Human Cell Atlas Revolutionizes Understanding of Human Body
A new human cell atlas reveals thousands of previously unknown cell types, transforming our understanding of the human body and paving the way for new treatments.

Human Cell Atlas Revolutionizes Understanding of Human Body
A new human cell atlas reveals thousands of previously unknown cell types, transforming our understanding of the human body and paving the way for new treatments.
Progress
24% Bias Score
Showing 85 to 96 of 169 results