Long COVID: Blood Biomarkers, Paxlovid Trials, and Repeated Infection Risks
Research worldwide reveals potential biomarkers for long COVID, including unusual T-cell activity and elevated interferon-gamma, with studies exploring the antiviral drug Paxlovid's impact and the link between repeated COVID infections and long COVID risk.
Long COVID: Blood Biomarkers, Paxlovid Trials, and Repeated Infection Risks
Research worldwide reveals potential biomarkers for long COVID, including unusual T-cell activity and elevated interferon-gamma, with studies exploring the antiviral drug Paxlovid's impact and the link between repeated COVID infections and long COVID risk.
Progress
24% Bias Score
Stimulant Medications Most Effective for Adult ADHD, Study Finds
A new study of nearly 15,000 adults with ADHD found that stimulant medications and atomoxetine were more effective than placebos at reducing core symptoms over 12 weeks, while non-pharmacological treatments showed mixed results, highlighting the need for further research into long-term effectiveness...
Stimulant Medications Most Effective for Adult ADHD, Study Finds
A new study of nearly 15,000 adults with ADHD found that stimulant medications and atomoxetine were more effective than placebos at reducing core symptoms over 12 weeks, while non-pharmacological treatments showed mixed results, highlighting the need for further research into long-term effectiveness...
Progress
36% Bias Score
"Long COVID in Spain: Unclear Prevalence, Urgent Need for Improved Care"
"In Spain, five years after the initial coronavirus outbreak, the exact number of long COVID sufferers remains unknown, due to the lack of a specific test. While estimates reach millions, the ongoing impact and the prevalence of chronic symptoms are not precisely known. The situation highlights the ...
"Long COVID in Spain: Unclear Prevalence, Urgent Need for Improved Care"
"In Spain, five years after the initial coronavirus outbreak, the exact number of long COVID sufferers remains unknown, due to the lack of a specific test. While estimates reach millions, the ongoing impact and the prevalence of chronic symptoms are not precisely known. The situation highlights the ...
Progress
48% Bias Score
Binge Eating Disorder in Spain: Prevalence, Characteristics, and Treatment
Binge eating disorder (BED), affecting 2-3% of the Spanish population, is characterized by episodes of uncontrolled eating, lacking compensatory behaviors, and often stemming from societal pressure and restrictive diets.
Binge Eating Disorder in Spain: Prevalence, Characteristics, and Treatment
Binge eating disorder (BED), affecting 2-3% of the Spanish population, is characterized by episodes of uncontrolled eating, lacking compensatory behaviors, and often stemming from societal pressure and restrictive diets.
Progress
40% Bias Score
Missing Protein Segment Linked to 80% of Autism Cases
A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.
Missing Protein Segment Linked to 80% of Autism Cases
A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.
Progress
32% Bias Score
Living with HIV: Personal accounts reveal emotional and social challenges
Five individuals share their experiences of living with HIV in France and Switzerland, highlighting the emotional challenges of diagnosis, the evolving understanding of the disease, and the persistent stigma surrounding it.
Living with HIV: Personal accounts reveal emotional and social challenges
Five individuals share their experiences of living with HIV in France and Switzerland, highlighting the emotional challenges of diagnosis, the evolving understanding of the disease, and the persistent stigma surrounding it.
Progress
28% Bias Score
New Cardiovascular Risk Assessment Tool Highlights Metabolic Syndrome's Impact
Despite progress in treating traditional risk factors, the rise of metabolic disorders like obesity and diabetes is increasing cardiovascular disease in the US, prompting the American College of Cardiology to introduce the Prevent risk assessment tool, which incorporates metabolic and kidney health ...
New Cardiovascular Risk Assessment Tool Highlights Metabolic Syndrome's Impact
Despite progress in treating traditional risk factors, the rise of metabolic disorders like obesity and diabetes is increasing cardiovascular disease in the US, prompting the American College of Cardiology to introduce the Prevent risk assessment tool, which incorporates metabolic and kidney health ...
Progress
20% Bias Score
EU Cancer Survival Rates Vary Widely by Country and Cancer Type
In 2021, cancer was the second leading cause of death in the European Union, with 1.1 million fatalities (21.6% of total deaths); survival rates vary significantly across countries and cancer types due to differences in diagnosis stage, treatment availability, and healthcare system organization.
EU Cancer Survival Rates Vary Widely by Country and Cancer Type
In 2021, cancer was the second leading cause of death in the European Union, with 1.1 million fatalities (21.6% of total deaths); survival rates vary significantly across countries and cancer types due to differences in diagnosis stage, treatment availability, and healthcare system organization.
Progress
16% Bias Score
China Sets Ambitious HIV/AIDS Prevention Goals for 2030
China's new plan aims to reduce its HIV prevalence rate to below 0.2% by 2030 by tackling high infection rates among men who have sex with men and covert transmission among heterosexual couples, focusing on increased public awareness, improved testing, and treatment access.
China Sets Ambitious HIV/AIDS Prevention Goals for 2030
China's new plan aims to reduce its HIV prevalence rate to below 0.2% by 2030 by tackling high infection rates among men who have sex with men and covert transmission among heterosexual couples, focusing on increased public awareness, improved testing, and treatment access.
Progress
40% Bias Score
Enugu State Exceeds UN HIV/AIDS Viral Suppression Target
In Enugu state, Nigeria, the Catholic Caritas Foundation reports that 98 percent of identified HIV-positive individuals have achieved viral suppression, exceeding the UN target, due to increased testing, treatment, and collaborative efforts with government and NGOs, resulting in a decrease in HIV pr...
Enugu State Exceeds UN HIV/AIDS Viral Suppression Target
In Enugu state, Nigeria, the Catholic Caritas Foundation reports that 98 percent of identified HIV-positive individuals have achieved viral suppression, exceeding the UN target, due to increased testing, treatment, and collaborative efforts with government and NGOs, resulting in a decrease in HIV pr...
Progress
44% Bias Score
Funding Shortfall Threatens Progress Against HIV/AIDS in Africa
Despite remarkable progress in reducing HIV infections in sub-Saharan Africa (59% reduction in eastern and southern Africa, 46% in west and central Africa since 2001), a funding shortfall of US$8.5 billion (2022) threatens sustainability, as 9.2 million lack treatment and 630,000 died in 2023.
Funding Shortfall Threatens Progress Against HIV/AIDS in Africa
Despite remarkable progress in reducing HIV infections in sub-Saharan Africa (59% reduction in eastern and southern Africa, 46% in west and central Africa since 2001), a funding shortfall of US$8.5 billion (2022) threatens sustainability, as 9.2 million lack treatment and 630,000 died in 2023.
Progress
40% Bias Score
Advances and Challenges in Cancer Treatment
Experts discuss advancements and challenges in treating lung, breast, ovarian, and biliary tract cancers, highlighting the roles of immunotherapy, liquid biopsies, and AI.
Advances and Challenges in Cancer Treatment
Experts discuss advancements and challenges in treating lung, breast, ovarian, and biliary tract cancers, highlighting the roles of immunotherapy, liquid biopsies, and AI.
Progress
0% Bias Score