Tag #Treatment

Showing 49 to 60 of 94 results

euronews.com

🌐 85% Global Worthiness

Dec 15, 19:11

EU Cancer Survival Rates Vary Widely by Country and Cancer Type

In 2021, cancer was the second leading cause of death in the European Union, with 1.1 million fatalities (21.6% of total deaths); survival rates vary significantly across countries and cancer types due to differences in diagnosis stage, treatment availability, and healthcare system organization.

EU Cancer Survival Rates Vary Widely by Country and Cancer Type

In 2021, cancer was the second leading cause of death in the European Union, with 1.1 million fatalities (21.6% of total deaths); survival rates vary significantly across countries and cancer types due to differences in diagnosis stage, treatment availability, and healthcare system organization.

Progress

16% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

What are the most significant factors contributing to the wide variations in cancer survival rates across European countries?

In 2021, cancer caused 1.1 million deaths in the EU, representing 21.6% of all deaths. Survival rates vary drastically by cancer type and country, highlighting significant healthcare disparities across Europe.

usa.chinadaily.com.cn

🌐 85% Global Worthiness

Dec 13, 04:09

China Sets Ambitious HIV/AIDS Prevention Goals for 2030

China's new plan aims to reduce its HIV prevalence rate to below 0.2% by 2030 by tackling high infection rates among men who have sex with men and covert transmission among heterosexual couples, focusing on increased public awareness, improved testing, and treatment access.

China Sets Ambitious HIV/AIDS Prevention Goals for 2030

China's new plan aims to reduce its HIV prevalence rate to below 0.2% by 2030 by tackling high infection rates among men who have sex with men and covert transmission among heterosexual couples, focusing on increased public awareness, improved testing, and treatment access.

Progress

40% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

What are the potential long-term consequences if China fails to meet its HIV/AIDS prevention goals by 2030?

The success of China's HIV/AIDS prevention strategy hinges on effectively addressing the challenges posed by high infection rates among MSM and covert transmission among heterosexual couples. Achieving the 95-95-95 targets by 2030 (95% awareness, 95% on treatment, 95% viral suppression) will require sustained investment in public health initiatives, targeted prevention programs for high-risk groups, and widespread access to affordable and effective treatment. Failure to do so could result in a resurgence of the epidemic.

allafrica.com

🌐 85% Global Worthiness

Dec 6, 22:11

Enugu State Exceeds UN HIV/AIDS Viral Suppression Target

In Enugu state, Nigeria, the Catholic Caritas Foundation reports that 98 percent of identified HIV-positive individuals have achieved viral suppression, exceeding the UN target, due to increased testing, treatment, and collaborative efforts with government and NGOs, resulting in a decrease in HIV pr...

Enugu State Exceeds UN HIV/AIDS Viral Suppression Target

In Enugu state, Nigeria, the Catholic Caritas Foundation reports that 98 percent of identified HIV-positive individuals have achieved viral suppression, exceeding the UN target, due to increased testing, treatment, and collaborative efforts with government and NGOs, resulting in a decrease in HIV pr...

Progress

44% Bias Score

ShareSaveArticle

12345678

Previous 1 of 8 Next

What is the current status of HIV/AIDS in Enugu state, Nigeria, and what factors contributed to the positive outcomes?

In Enugu state, Nigeria, the Catholic Caritas Foundation reports a 98% viral suppression rate among identified HIV-positive individuals, exceeding the UN's 95% target. This success is attributed to increased testing and treatment, raising the number of patients from 18,000 in 2017 to 50,000 currently, and pediatric patients from 200 to over 3,000. The state's overall HIV prevalence has also dropped from 5.1% in 2010 to 2.1% currently.

allafrica.com

🌐 85% Global Worthiness

Dec 2, 10:46

Funding Shortfall Threatens Progress Against HIV/AIDS in Africa

Despite remarkable progress in reducing HIV infections in sub-Saharan Africa (59% reduction in eastern and southern Africa, 46% in west and central Africa since 2001), a funding shortfall of US$8.5 billion (2022) threatens sustainability, as 9.2 million lack treatment and 630,000 died in 2023.

Funding Shortfall Threatens Progress Against HIV/AIDS in Africa

Despite remarkable progress in reducing HIV infections in sub-Saharan Africa (59% reduction in eastern and southern Africa, 46% in west and central Africa since 2001), a funding shortfall of US$8.5 billion (2022) threatens sustainability, as 9.2 million lack treatment and 630,000 died in 2023.

Progress

40% Bias Score

ShareSaveArticle

12345678

Previous 1 of 8 Next

What is the current status of HIV/AIDS funding globally and in Africa, and how does it impact treatment access and mortality rates?

In 2023, 39.9 million people globally lived with HIV; 9.2 million lacked access to antiretroviral treatment, and 630,000 died from AIDS. Sub-Saharan Africa, bearing 65% of the global HIV burden, has seen significant progress: a 59% reduction in new infections in eastern and southern Africa and 46% in west and central Africa between 2001 and 2023. However, funding shortfalls threaten this progress, with only US$20.8 billion available in 2022 against a needed US$29.3 billion by 2025.

lemonde.fr

🌐 % Global Worthiness

Nov 15, 16:03

EMA Approves Alzheimer's Drug Leqembi

The European Medicines Agency approves Leqembi, a new Alzheimer's drug, with strict conditions to mitigate serious side effects.

EMA Approves Alzheimer's Drug Leqembi

The European Medicines Agency approves Leqembi, a new Alzheimer's drug, with strict conditions to mitigate serious side effects.

Progress

0% Bias Score

ShareSaveArticle

12345678910

Previous 1 of 10 Next

How will access to Leqembi be managed?

The drug will be available through a controlled access program to ensure it's used only in the recommended patient population. This program requires MRI monitoring for side effects before treatment and at specific intervals thereafter.

elmundo.es

🌐 % Global Worthiness

Nov 15, 04:12

Advances and Challenges in Cancer Treatment

Experts discuss advancements and challenges in treating lung, breast, ovarian, and biliary tract cancers, highlighting the roles of immunotherapy, liquid biopsies, and AI.

Advances and Challenges in Cancer Treatment

Experts discuss advancements and challenges in treating lung, breast, ovarian, and biliary tract cancers, highlighting the roles of immunotherapy, liquid biopsies, and AI.

Progress

0% Bias Score

ShareSaveArticle

12345678910

Previous 1 of 10 Next

What are the main challenges in treating ovarian cancer?

Early diagnosis remains a significant hurdle in ovarian cancer due to nonspecific initial symptoms; better public education about persistent symptoms is needed.

elpais.com

🌐 85% Global Worthiness

Dec 13, 10:10

"Long COVID in Spain: Unclear Prevalence, Urgent Need for Improved Care"

"In Spain, five years after the initial coronavirus outbreak, the exact number of long COVID sufferers remains unknown, due to the lack of a specific test. While estimates reach millions, the ongoing impact and the prevalence of chronic symptoms are not precisely known. The situation highlights the ...

"Long COVID in Spain: Unclear Prevalence, Urgent Need for Improved Care"

"In Spain, five years after the initial coronavirus outbreak, the exact number of long COVID sufferers remains unknown, due to the lack of a specific test. While estimates reach millions, the ongoing impact and the prevalence of chronic symptoms are not precisely known. The situation highlights the ...

Progress

48% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

"What is the current understanding of long COVID's prevalence and impact on the Spanish population, considering diagnostic challenges and evolving knowledge?"

"Five years after the first detection of coronavirus in China, the exact number of people suffering from long COVID remains unknown. This illness is undetectable through standard biological tests, leading to frequent misunderstandings from society and some doctors who doubt its existence. Patients often face accusations of malingering, hindering their ability to work and access appropriate care.", "A significant challenge is the lack of a specific diagnostic test, making it difficult to accurately determine prevalence. Estimates suggest millions affected in Spain alone, but these figures are outdated due to the evolving nature of long COVID and the lack of ongoing monitoring. The variability of symptoms and the long-term impact on individuals further complicate the situation.", "Looking ahead, there's a critical need for improved medical training and resources. The creation of multidisciplinary units is essential, to coordinate care and improve diagnostic accuracy. Further research into effective treatments is vital, given the absence of a specific cure, and to evaluate numerous unproven treatments currently used."

elpais.com

🌐 75% Global Worthiness

Dec 8, 01:05

Binge Eating Disorder in Spain: Prevalence, Characteristics, and Treatment

Binge eating disorder (BED), affecting 2-3% of the Spanish population, is characterized by episodes of uncontrolled eating, lacking compensatory behaviors, and often stemming from societal pressure and restrictive diets.

Binge Eating Disorder in Spain: Prevalence, Characteristics, and Treatment

Binge eating disorder (BED), affecting 2-3% of the Spanish population, is characterized by episodes of uncontrolled eating, lacking compensatory behaviors, and often stemming from societal pressure and restrictive diets.

Progress

40% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

What are the key characteristics of binge eating disorder and its prevalence in Spain?

Binge eating disorder (BED), recognized in the DSM-5 in 2013, affects 2-3% of the Spanish population, predominantly women. Unlike bulimia, BED lacks compensatory behaviors like purging, but includes food restriction.

elpais.com

🌐 85% Global Worthiness

Dec 5, 10:08

Missing Protein Segment Linked to 80% of Autism Cases

A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.

Missing Protein Segment Linked to 80% of Autism Cases

A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.

Progress

32% Bias Score

ShareSaveArticle

Good Health and Well-being

12345678

Previous 1 of 8 Next

What specific genetic mechanism is responsible for a significant portion of autism cases, and how might this discovery lead to new treatments?

Scientists have discovered that a missing segment of the CPEB4 protein, crucial for brain development, is linked to autism in 80% of cases. This 24-letter DNA sequence (GCAAGGACATATGGGCGAAGGAGA) codes for eight amino acids; their absence causes protein aggregation, disrupting 200 autism-related genes.

liberation.fr

🌐 75% Global Worthiness

Nov 29, 01:45

Living with HIV: Personal accounts reveal emotional and social challenges

Five individuals share their experiences of living with HIV in France and Switzerland, highlighting the emotional challenges of diagnosis, the evolving understanding of the disease, and the persistent stigma surrounding it.

Living with HIV: Personal accounts reveal emotional and social challenges

Five individuals share their experiences of living with HIV in France and Switzerland, highlighting the emotional challenges of diagnosis, the evolving understanding of the disease, and the persistent stigma surrounding it.

Progress

28% Bias Score

ShareSaveArticle

12345678

Previous 1 of 8 Next

What are the immediate emotional and social challenges faced by individuals upon receiving an HIV diagnosis?

Several individuals share their experiences of receiving an HIV diagnosis, highlighting the emotional and social challenges, but also the advancements in treatment that enable those with HIV to live full lives, including having children.

welt.de

🌐 % Global Worthiness

Nov 15, 04:06

Lecanemab: EMA Approval and Limitations

EMA approves Lecanemab, a new Alzheimer's drug targeting amyloid plaques, but with limitations due to side effects and treatment complexity.

Lecanemab: EMA Approval and Limitations

EMA approves Lecanemab, a new Alzheimer's drug targeting amyloid plaques, but with limitations due to side effects and treatment complexity.

Progress

0% Bias Score

ShareSaveArticle

12345678910

Previous 1 of 10 Next

What are the limitations and restrictions placed on the use of Lecanemab by the EMA?

The EMA's approval of Lecanemab is limited to patients with mild cognitive impairment or mild dementia in the early stages of Alzheimer's and those with one or zero copies of the ApoE4 gene to mitigate risks of serious side effects like brain swelling and bleeding.

arabic.cnn.com

🌐 % Global Worthiness

Nov 15, 13:07

Understanding and Treating Tension Headaches

Tension headaches are the most common type of headache and are characterized by pain or discomfort in the head, scalp, or neck. Treatment involves pain relievers, stress management, and other therapies.

Understanding and Treating Tension Headaches

Tension headaches are the most common type of headache and are characterized by pain or discomfort in the head, scalp, or neck. Treatment involves pain relievers, stress management, and other therapies.

Progress

0% Bias Score

ShareSaveArticle

12345678910

Previous 1 of 10 Next

How do tension headaches manifest physically?

Tension headaches are triggered by tense or contracted neck and scalp muscles. These contractions can result from stress, depression, head injuries, or anxiety.

Showing 49 to 60 of 94 results