Tag #Treatment

Showing 97 to 108 of 142 results

euronews.com
🌐 85% Global Worthiness
News related image

EU Cancer Survival Rates Vary Widely by Country and Cancer Type

In 2021, cancer was the second leading cause of death in the European Union, with 1.1 million fatalities (21.6% of total deaths); survival rates vary significantly across countries and cancer types due to differences in diagnosis stage, treatment availability, and healthcare system organization.

Progress

16% Bias Score

Good Health and Well-being
elpais.com
🌐 85% Global Worthiness
News related image

"Long COVID in Spain: Unclear Prevalence, Urgent Need for Improved Care"

"In Spain, five years after the initial coronavirus outbreak, the exact number of long COVID sufferers remains unknown, due to the lack of a specific test. While estimates reach millions, the ongoing impact and the prevalence of chronic symptoms are not precisely known. The situation highlights the ...

Progress

48% Bias Score

Good Health and Well-being
allafrica.com
🌐 85% Global Worthiness
News related image

Enugu State Exceeds UN HIV/AIDS Viral Suppression Target

In Enugu state, Nigeria, the Catholic Caritas Foundation reports that 98 percent of identified HIV-positive individuals have achieved viral suppression, exceeding the UN target, due to increased testing, treatment, and collaborative efforts with government and NGOs, resulting in a decrease in HIV pr...

Progress

44% Bias Score

allafrica.com
🌐 85% Global Worthiness
News related image

Funding Shortfall Threatens Progress Against HIV/AIDS in Africa

Despite remarkable progress in reducing HIV infections in sub-Saharan Africa (59% reduction in eastern and southern Africa, 46% in west and central Africa since 2001), a funding shortfall of US$8.5 billion (2022) threatens sustainability, as 9.2 million lack treatment and 630,000 died in 2023.

Progress

40% Bias Score

welt.de
🌐 % Global Worthiness
News related image

Lecanemab: EMA Approval and Limitations

EMA approves Lecanemab, a new Alzheimer's drug targeting amyloid plaques, but with limitations due to side effects and treatment complexity.

Progress

0% Bias Score

arabic.cnn.com
🌐 % Global Worthiness
News related image

Understanding and Treating Tension Headaches

Tension headaches are the most common type of headache and are characterized by pain or discomfort in the head, scalp, or neck. Treatment involves pain relievers, stress management, and other therapies.

Progress

0% Bias Score

usa.chinadaily.com.cn
🌐 85% Global Worthiness
News related image

China Sets Ambitious HIV/AIDS Prevention Goals for 2030

China's new plan aims to reduce its HIV prevalence rate to below 0.2% by 2030 by tackling high infection rates among men who have sex with men and covert transmission among heterosexual couples, focusing on increased public awareness, improved testing, and treatment access.

Progress

40% Bias Score

Good Health and Well-being
elpais.com
🌐 75% Global Worthiness
News related image

Binge Eating Disorder in Spain: Prevalence, Characteristics, and Treatment

Binge eating disorder (BED), affecting 2-3% of the Spanish population, is characterized by episodes of uncontrolled eating, lacking compensatory behaviors, and often stemming from societal pressure and restrictive diets.

Progress

40% Bias Score

Good Health and Well-being
elpais.com
🌐 85% Global Worthiness
News related image

Missing Protein Segment Linked to 80% of Autism Cases

A missing eight-amino-acid segment in the CPEB4 protein, coded by the DNA sequence GCAAGGACATATGGGCGAAGGAGA, is linked to autism in 80% of cases, potentially offering a new therapeutic target.

Progress

32% Bias Score

Good Health and Well-being
liberation.fr
🌐 75% Global Worthiness
News related image

Living with HIV: Personal accounts reveal emotional and social challenges

Five individuals share their experiences of living with HIV in France and Switzerland, highlighting the emotional challenges of diagnosis, the evolving understanding of the disease, and the persistent stigma surrounding it.

Progress

28% Bias Score

elmundo.es
🌐 % Global Worthiness
News related image

Advances and Challenges in Cancer Treatment

Experts discuss advancements and challenges in treating lung, breast, ovarian, and biliary tract cancers, highlighting the roles of immunotherapy, liquid biopsies, and AI.

Progress

0% Bias Score

liberation.fr
🌐 % Global Worthiness
News related image

EMA Approves Leqembi for Alzheimer's

The European Medicines Agency approves Leqembi, a new Alzheimer's treatment to reduce cognitive decline in early-stage patients. The drug targets amyloid plaques in the brain and has already received approvals in other countries.

Progress

0% Bias Score

Showing 97 to 108 of 142 results